From 6d053b51aa192407aee4b111d0b018a27742be7a Mon Sep 17 00:00:00 2001
From: Yanni Papandreou <nepo1y@gmail.com>
Date: Sun, 26 Jul 2026 17:43:59 +0100
Subject: [PATCH 01/14] added nucleotide-count exercise

---
 config.json                                   | 10 +++++++-
 .../nucleotide-count/.docs/instructions.md    | 23 +++++++++++++++++
 .../nucleotide-count/.meta/config.json        | 19 ++++++++++++++
 .../nucleotide-count/.meta/example.nu         | 22 ++++++++++++++++
 .../nucleotide-count/.meta/tests.toml         | 25 +++++++++++++++++++
 .../nucleotide-count/nucleotide-count.nu      |  3 +++
 exercises/practice/nucleotide-count/tests.nu  | 10 ++++++++
 7 files changed, 111 insertions(+), 1 deletion(-)
 create mode 100644 exercises/practice/nucleotide-count/.docs/instructions.md
 create mode 100644 exercises/practice/nucleotide-count/.meta/config.json
 create mode 100644 exercises/practice/nucleotide-count/.meta/example.nu
 create mode 100644 exercises/practice/nucleotide-count/.meta/tests.toml
 create mode 100644 exercises/practice/nucleotide-count/nucleotide-count.nu
 create mode 100644 exercises/practice/nucleotide-count/tests.nu

diff --git a/config.json b/config.json
index 6c35fea..0222b2c 100644
--- a/config.json
+++ b/config.json
@@ -149,6 +149,14 @@
         "practices": [],
         "prerequisites": [],
         "difficulty": 3
+      },
+      {
+        "slug": "nucleotide-count",
+        "name": "Nucleotide Count",
+        "uuid": "f02a6a6d-f0c8-428c-b30d-b1d805ed0c5d",
+        "practices": [],
+        "prerequisites": [],
+        "difficulty": 1
       }
     ]
   },
@@ -162,4 +170,4 @@
     "typing/static",
     "used_for/scripts"
   ]
-}
\ No newline at end of file
+}
diff --git a/exercises/practice/nucleotide-count/.docs/instructions.md b/exercises/practice/nucleotide-count/.docs/instructions.md
new file mode 100644
index 0000000..548d9ba
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.docs/instructions.md
@@ -0,0 +1,23 @@
+# Instructions
+
+Each of us inherits from our biological parents a set of chemical instructions known as DNA that influence how our bodies are constructed.
+All known life depends on DNA!
+
+> Note: You do not need to understand anything about nucleotides or DNA to complete this exercise.
+
+DNA is a long chain of other chemicals and the most important are the four nucleotides, adenine, cytosine, guanine and thymine.
+A single DNA chain can contain billions of these four nucleotides and the order in which they occur is important!
+We call the order of these nucleotides in a bit of DNA a "DNA sequence".
+
+We represent a DNA sequence as an ordered collection of these four nucleotides and a common way to do that is with a string of characters such as "ATTACG" for a DNA sequence of 6 nucleotides.
+'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' for thymine.
+
+Given a string representing a DNA sequence, count how many of each nucleotide is present.
+If the string contains characters that aren't A, C, G, or T then it is invalid and you should signal an error.
+
+For example:
+
+```text
+"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2
+"INVALID" -> error
+```
diff --git a/exercises/practice/nucleotide-count/.meta/config.json b/exercises/practice/nucleotide-count/.meta/config.json
new file mode 100644
index 0000000..90c4b6c
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.meta/config.json
@@ -0,0 +1,19 @@
+{
+  "authors": [
+    "YanniPapandreou"
+  ],
+  "files": {
+    "solution": [
+      "nucleotide-count.nu"
+    ],
+    "test": [
+      "tests.nu"
+    ],
+    "example": [
+      ".meta/example.nu"
+    ]
+  },
+  "blurb": "Given a DNA string, compute how many times each nucleotide occurs in the string.",
+  "source": "The Calculating DNA Nucleotides_problem at Rosalind",
+  "source_url": "https://rosalind.info/problems/dna/"
+}
diff --git a/exercises/practice/nucleotide-count/.meta/example.nu b/exercises/practice/nucleotide-count/.meta/example.nu
new file mode 100644
index 0000000..65f6e6f
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.meta/example.nu
@@ -0,0 +1,22 @@
+export def nucleotideCounts [strand: string] {
+    let chars = $strand
+    | split chars
+
+    if ($chars | any {|c| not ($c in [A C G T])}) {
+        error make {msg: "Invalid nucleotide in strand"}
+    }
+
+    let data = $chars
+    | uniq -c
+
+    let counts = $data.value
+    | zip $data.count
+    | into record
+
+    {
+        A: 0
+        C: 0
+        G: 0
+        T: 0
+    } | merge $counts
+}
diff --git a/exercises/practice/nucleotide-count/.meta/tests.toml b/exercises/practice/nucleotide-count/.meta/tests.toml
new file mode 100644
index 0000000..7c55e53
--- /dev/null
+++ b/exercises/practice/nucleotide-count/.meta/tests.toml
@@ -0,0 +1,25 @@
+# This is an auto-generated file.
+#
+# Regenerating this file via `configlet sync` will:
+# - Recreate every `description` key/value pair
+# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications
+# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion)
+# - Preserve any other key/value pair
+#
+# As user-added comments (using the # character) will be removed when this file
+# is regenerated, comments can be added via a `comment` key.
+
+[3e5c30a8-87e2-4845-a815-a49671ade970]
+description = "empty strand"
+
+[a0ea42a6-06d9-4ac6-828c-7ccaccf98fec]
+description = "can count one nucleotide in single-character input"
+
+[eca0d565-ed8c-43e7-9033-6cefbf5115b5]
+description = "strand with repeated nucleotide"
+
+[40a45eac-c83f-4740-901a-20b22d15a39f]
+description = "strand with multiple nucleotides"
+
+[b4c47851-ee9e-4b0a-be70-a86e343bd851]
+description = "strand with invalid nucleotides"
diff --git a/exercises/practice/nucleotide-count/nucleotide-count.nu b/exercises/practice/nucleotide-count/nucleotide-count.nu
new file mode 100644
index 0000000..da35bea
--- /dev/null
+++ b/exercises/practice/nucleotide-count/nucleotide-count.nu
@@ -0,0 +1,3 @@
+export def nucleotideCounts [strand: string] {
+    error make {msg: "Please implement nucleotideCounts"}
+}
diff --git a/exercises/practice/nucleotide-count/tests.nu b/exercises/practice/nucleotide-count/tests.nu
new file mode 100644
index 0000000..b389215
--- /dev/null
+++ b/exercises/practice/nucleotide-count/tests.nu
@@ -0,0 +1,10 @@
+use nucleotide-count.nu nucleotideCounts
+use std/assert
+
+assert equal (nucleotideCounts "") {A: 0, C: 0, G: 0, T: 0}
+assert equal (nucleotideCounts "G") {A: 0, C: 0, G: 1, T: 0}
+assert equal (nucleotideCounts "GGGGGGG") {A: 0, C: 0, G: 7, T: 0}
+assert equal (
+    nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
+) {A: 20, C: 12, G: 17, T: 21}
+assert error {|| (nucleotideCounts "AGXXACT")}

From 8e78ae99ff8d9c69e4a2f5f4b483a78cc5aac61f Mon Sep 17 00:00:00 2001
From: Yanni Papandreou <nepo1y@gmail.com>
Date: Sun, 26 Jul 2026 18:12:21 +0100
Subject: [PATCH 02/14] added allergies exercise

also corrected difficulty for nucleotide-count
---
 config.json                                   |  10 +-
 .../practice/allergies/.docs/instructions.md  |  27 +++
 .../practice/allergies/.meta/config.json      |  19 +++
 exercises/practice/allergies/.meta/example.nu |  27 +++
 exercises/practice/allergies/.meta/tests.toml | 160 ++++++++++++++++++
 exercises/practice/allergies/allergies.nu     |   7 +
 exercises/practice/allergies/tests.nu         | 105 ++++++++++++
 7 files changed, 354 insertions(+), 1 deletion(-)
 create mode 100644 exercises/practice/allergies/.docs/instructions.md
 create mode 100644 exercises/practice/allergies/.meta/config.json
 create mode 100644 exercises/practice/allergies/.meta/example.nu
 create mode 100644 exercises/practice/allergies/.meta/tests.toml
 create mode 100644 exercises/practice/allergies/allergies.nu
 create mode 100644 exercises/practice/allergies/tests.nu

diff --git a/config.json b/config.json
index 0222b2c..3f614c1 100644
--- a/config.json
+++ b/config.json
@@ -156,7 +156,15 @@
         "uuid": "f02a6a6d-f0c8-428c-b30d-b1d805ed0c5d",
         "practices": [],
         "prerequisites": [],
-        "difficulty": 1
+        "difficulty": 2
+      },
+      {
+        "slug": "allergies",
+        "name": "Allergies",
+        "uuid": "af02524b-1972-4c50-b91b-e0ee0355ca07",
+        "practices": [],
+        "prerequisites": [],
+        "difficulty": 2
       }
     ]
   },
diff --git a/exercises/practice/allergies/.docs/instructions.md b/exercises/practice/allergies/.docs/instructions.md
new file mode 100644
index 0000000..daf8cfd
--- /dev/null
+++ b/exercises/practice/allergies/.docs/instructions.md
@@ -0,0 +1,27 @@
+# Instructions
+
+Given a person's allergy score, determine whether or not they're allergic to a given item, and their full list of allergies.
+
+An allergy test produces a single numeric score which contains the information about all the allergies the person has (that they were tested for).
+
+The list of items (and their value) that were tested are:
+
+- eggs (1)
+- peanuts (2)
+- shellfish (4)
+- strawberries (8)
+- tomatoes (16)
+- chocolate (32)
+- pollen (64)
+- cats (128)
+
+So if Tom is allergic to peanuts and chocolate, he gets a score of 34.
+
+Now, given just that score of 34, your program should be able to say:
+
+- Whether Tom is allergic to any one of those allergens listed above.
+- All the allergens Tom is allergic to.
+
+Note: a given score may include allergens **not** listed above (i.e. allergens that score 256, 512, 1024, etc.).
+Your program should ignore those components of the score.
+For example, if the allergy score is 257, your program should only report the eggs (1) allergy.
diff --git a/exercises/practice/allergies/.meta/config.json b/exercises/practice/allergies/.meta/config.json
new file mode 100644
index 0000000..a30052e
--- /dev/null
+++ b/exercises/practice/allergies/.meta/config.json
@@ -0,0 +1,19 @@
+{
+  "authors": [
+    "YanniPapandreou"
+  ],
+  "files": {
+    "solution": [
+      "allergies.nu"
+    ],
+    "test": [
+      "tests.nu"
+    ],
+    "example": [
+      ".meta/example.nu"
+    ]
+  },
+  "blurb": "Given a person's allergy score, determine whether or not they're allergic to a given item, and their full list of allergies.",
+  "source": "Exercise by the JumpstartLab team for students at The Turing School of Software and Design.",
+  "source_url": "https://www.turing.edu/"
+}
diff --git a/exercises/practice/allergies/.meta/example.nu b/exercises/practice/allergies/.meta/example.nu
new file mode 100644
index 0000000..10137a7
--- /dev/null
+++ b/exercises/practice/allergies/.meta/example.nu
@@ -0,0 +1,27 @@
+const ALLERGENS = [
+    eggs
+    peanuts
+    shellfish
+    strawberries
+    tomatoes
+    chocolate
+    pollen
+    cats
+]
+
+def get_value [item: string] {
+    $ALLERGENS
+    | enumerate
+    | where {|row| $row.item == $item}
+    | 2 ** ($in.index.0)
+}
+
+export def allergicTo [item: string, score: int] {
+    let value = get_value $item
+    ($score bit-and $value) != 0
+}
+
+export def list [score: int] {
+    $ALLERGENS
+    | where {|allergen| allergicTo $allergen $score}
+}
diff --git a/exercises/practice/allergies/.meta/tests.toml b/exercises/practice/allergies/.meta/tests.toml
new file mode 100644
index 0000000..799ab85
--- /dev/null
+++ b/exercises/practice/allergies/.meta/tests.toml
@@ -0,0 +1,160 @@
+# This is an auto-generated file.
+#
+# Regenerating this file via `configlet sync` will:
+# - Recreate every `description` key/value pair
+# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications
+# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion)
+# - Preserve any other key/value pair
+#
+# As user-added comments (using the # character) will be removed when this file
+# is regenerated, comments can be added via a `comment` key.
+
+[17fc7296-2440-4ac4-ad7b-d07c321bc5a0]
+description = "testing for eggs allergy -> not allergic to anything"
+
+[07ced27b-1da5-4c2e-8ae2-cb2791437546]
+description = "testing for eggs allergy -> allergic only to eggs"
+
+[5035b954-b6fa-4b9b-a487-dae69d8c5f96]
+description = "testing for eggs allergy -> allergic to eggs and something else"
+
+[64a6a83a-5723-4b5b-a896-663307403310]
+description = "testing for eggs allergy -> allergic to something, but not eggs"
+
+[90c8f484-456b-41c4-82ba-2d08d93231c6]
+description = "testing for eggs allergy -> allergic to everything"
+
+[d266a59a-fccc-413b-ac53-d57cb1f0db9d]
+description = "testing for peanuts allergy -> not allergic to anything"
+
+[ea210a98-860d-46b2-a5bf-50d8995b3f2a]
+description = "testing for peanuts allergy -> allergic only to peanuts"
+
+[eac69ae9-8d14-4291-ac4b-7fd2c73d3a5b]
+description = "testing for peanuts allergy -> allergic to peanuts and something else"
+
+[9152058c-ce39-4b16-9b1d-283ec6d25085]
+description = "testing for peanuts allergy -> allergic to something, but not peanuts"
+
+[d2d71fd8-63d5-40f9-a627-fbdaf88caeab]
+description = "testing for peanuts allergy -> allergic to everything"
+
+[b948b0a1-cbf7-4b28-a244-73ff56687c80]
+description = "testing for shellfish allergy -> not allergic to anything"
+
+[9ce9a6f3-53e9-4923-85e0-73019047c567]
+description = "testing for shellfish allergy -> allergic only to shellfish"
+
+[b272fca5-57ba-4b00-bd0c-43a737ab2131]
+description = "testing for shellfish allergy -> allergic to shellfish and something else"
+
+[21ef8e17-c227-494e-8e78-470a1c59c3d8]
+description = "testing for shellfish allergy -> allergic to something, but not shellfish"
+
+[cc789c19-2b5e-4c67-b146-625dc8cfa34e]
+description = "testing for shellfish allergy -> allergic to everything"
+
+[651bde0a-2a74-46c4-ab55-02a0906ca2f5]
+description = "testing for strawberries allergy -> not allergic to anything"
+
+[b649a750-9703-4f5f-b7f7-91da2c160ece]
+description = "testing for strawberries allergy -> allergic only to strawberries"
+
+[50f5f8f3-3bac-47e6-8dba-2d94470a4bc6]
+description = "testing for strawberries allergy -> allergic to strawberries and something else"
+
+[23dd6952-88c9-48d7-a7d5-5d0343deb18d]
+description = "testing for strawberries allergy -> allergic to something, but not strawberries"
+
+[74afaae2-13b6-43a2-837a-286cd42e7d7e]
+description = "testing for strawberries allergy -> allergic to everything"
+
+[c49a91ef-6252-415e-907e-a9d26ef61723]
+description = "testing for tomatoes allergy -> not allergic to anything"
+
+[b69c5131-b7d0-41ad-a32c-e1b2cc632df8]
+description = "testing for tomatoes allergy -> allergic only to tomatoes"
+
+[1ca50eb1-f042-4ccf-9050-341521b929ec]
+description = "testing for tomatoes allergy -> allergic to tomatoes and something else"
+
+[e9846baa-456b-4eff-8025-034b9f77bd8e]
+description = "testing for tomatoes allergy -> allergic to something, but not tomatoes"
+
+[b2414f01-f3ad-4965-8391-e65f54dad35f]
+description = "testing for tomatoes allergy -> allergic to everything"
+
+[978467ab-bda4-49f7-b004-1d011ead947c]
+description = "testing for chocolate allergy -> not allergic to anything"
+
+[59cf4e49-06ea-4139-a2c1-d7aad28f8cbc]
+description = "testing for chocolate allergy -> allergic only to chocolate"
+
+[b0a7c07b-2db7-4f73-a180-565e07040ef1]
+description = "testing for chocolate allergy -> allergic to chocolate and something else"
+
+[f5506893-f1ae-482a-b516-7532ba5ca9d2]
+description = "testing for chocolate allergy -> allergic to something, but not chocolate"
+
+[02debb3d-d7e2-4376-a26b-3c974b6595c6]
+description = "testing for chocolate allergy -> allergic to everything"
+
+[17f4a42b-c91e-41b8-8a76-4797886c2d96]
+description = "testing for pollen allergy -> not allergic to anything"
+
+[7696eba7-1837-4488-882a-14b7b4e3e399]
+description = "testing for pollen allergy -> allergic only to pollen"
+
+[9a49aec5-fa1f-405d-889e-4dfc420db2b6]
+description = "testing for pollen allergy -> allergic to pollen and something else"
+
+[3cb8e79f-d108-4712-b620-aa146b1954a9]
+description = "testing for pollen allergy -> allergic to something, but not pollen"
+
+[1dc3fe57-7c68-4043-9d51-5457128744b2]
+description = "testing for pollen allergy -> allergic to everything"
+
+[d3f523d6-3d50-419b-a222-d4dfd62ce314]
+description = "testing for cats allergy -> not allergic to anything"
+
+[eba541c3-c886-42d3-baef-c048cb7fcd8f]
+description = "testing for cats allergy -> allergic only to cats"
+
+[ba718376-26e0-40b7-bbbe-060287637ea5]
+description = "testing for cats allergy -> allergic to cats and something else"
+
+[3c6dbf4a-5277-436f-8b88-15a206f2d6c4]
+description = "testing for cats allergy -> allergic to something, but not cats"
+
+[1faabb05-2b98-4995-9046-d83e4a48a7c1]
+description = "testing for cats allergy -> allergic to everything"
+
+[f9c1b8e7-7dc5-4887-aa93-cebdcc29dd8f]
+description = "list when: -> no allergies"
+
+[9e1a4364-09a6-4d94-990f-541a94a4c1e8]
+description = "list when: -> just eggs"
+
+[8851c973-805e-4283-9e01-d0c0da0e4695]
+description = "list when: -> just peanuts"
+
+[2c8943cb-005e-435f-ae11-3e8fb558ea98]
+description = "list when: -> just strawberries"
+
+[6fa95d26-044c-48a9-8a7b-9ee46ec32c5c]
+description = "list when: -> eggs and peanuts"
+
+[19890e22-f63f-4c5c-a9fb-fb6eacddfe8e]
+description = "list when: -> more than eggs but not peanuts"
+
+[4b68f470-067c-44e4-889f-c9fe28917d2f]
+description = "list when: -> lots of stuff"
+
+[0881b7c5-9efa-4530-91bd-68370d054bc7]
+description = "list when: -> everything"
+
+[12ce86de-b347-42a0-ab7c-2e0570f0c65b]
+description = "list when: -> no allergen score parts"
+
+[93c2df3e-4f55-4fed-8116-7513092819cd]
+description = "list when: -> no allergen score parts without highest valid score"
diff --git a/exercises/practice/allergies/allergies.nu b/exercises/practice/allergies/allergies.nu
new file mode 100644
index 0000000..d9a846e
--- /dev/null
+++ b/exercises/practice/allergies/allergies.nu
@@ -0,0 +1,7 @@
+export def allergicTo [item: string, score: int] {
+    error make {msg: "Please implement allergicTo"}
+}
+
+export def list [score: int] {
+    error make {msg: "Please implement list"}
+}
diff --git a/exercises/practice/allergies/tests.nu b/exercises/practice/allergies/tests.nu
new file mode 100644
index 0000000..bde44e0
--- /dev/null
+++ b/exercises/practice/allergies/tests.nu
@@ -0,0 +1,105 @@
+use allergies.nu [allergicTo list]
+use std/assert
+
+# testing for eggs allergy
+assert not (allergicTo eggs 0)
+assert (allergicTo eggs 1)
+assert (allergicTo eggs 3)
+assert not (allergicTo eggs 2)
+assert (allergicTo eggs 255)
+
+# testing for peanuts allergy
+assert not (allergicTo peanuts 0)
+assert (allergicTo peanuts 2)
+assert (allergicTo peanuts 7)
+assert not (allergicTo peanuts 5)
+assert (allergicTo peanuts 255)
+
+# testing for shellfish allergy
+assert not (allergicTo shellfish 0)
+assert (allergicTo shellfish 4)
+assert (allergicTo shellfish 14)
+assert not (allergicTo shellfish 10)
+assert (allergicTo shellfish 255)
+
+# testing for strawberries allergy
+assert not (allergicTo strawberries 0)
+assert (allergicTo strawberries 8)
+assert (allergicTo strawberries 28)
+assert not (allergicTo strawberries 20)
+assert (allergicTo strawberries 255)
+
+# testing for tomatoes allergy
+assert not (allergicTo tomatoes 0)
+assert (allergicTo tomatoes 16)
+assert (allergicTo tomatoes 56)
+assert not (allergicTo tomatoes 40)
+assert (allergicTo tomatoes 255)
+
+# testing for chocolate allergy
+assert not (allergicTo chocolate 0)
+assert (allergicTo chocolate 32)
+assert (allergicTo chocolate 112)
+assert not (allergicTo chocolate 80)
+assert (allergicTo chocolate 255)
+
+# testing for pollen allergy
+assert not (allergicTo pollen 0)
+assert (allergicTo pollen 64)
+assert (allergicTo pollen 224)
+assert not (allergicTo pollen 160)
+assert (allergicTo pollen 255)
+
+# testing for cats allergy
+assert not (allergicTo cats 0)
+assert (allergicTo cats 128)
+assert (allergicTo cats 192)
+assert not (allergicTo cats 64)
+assert (allergicTo cats 255)
+
+# no allergies
+assert equal (list 0) []
+
+# just eggs
+assert equal (list 1) [eggs]
+
+# just peanuts
+assert equal (list 2) [peanuts]
+
+# just strawberries
+assert equal (list 8) [strawberries]
+
+# eggs and peanuts
+assert equal (list 3) [eggs, peanuts]
+
+# more than eggs but not peanuts
+assert equal (list 5) [eggs, shellfish]
+
+# lots of stuff
+assert equal (list 248) [strawberries, tomatoes, chocolate, pollen, cats]
+
+# everything
+assert equal (list 255) [
+    eggs
+    peanuts
+    shellfish
+    strawberries
+    tomatoes
+    chocolate
+    pollen
+    cats
+]
+
+# no allergen score parts
+assert equal (list 509) [
+    eggs
+    shellfish
+    strawberries
+    tomatoes
+    chocolate
+    pollen
+    cats
+]
+
+# no allergen score parts without highest valid score
+assert equal (list 257) [eggs]

From b042cc4ab27cb8940a5e86b81e798e950e19df1e Mon Sep 17 00:00:00 2001
From: Yanni Papandreou <nepo1y@gmail.com>
Date: Sun, 26 Jul 2026 18:21:19 +0100
Subject: [PATCH 03/14] added leap

---
 config.json                                   |  8 ++++
 exercises/practice/leap/.docs/instructions.md |  3 ++
 exercises/practice/leap/.docs/introduction.md | 16 ++++++++
 exercises/practice/leap/.meta/config.json     | 19 ++++++++++
 exercises/practice/leap/.meta/example.nu      |  9 +++++
 exercises/practice/leap/.meta/tests.toml      | 37 +++++++++++++++++++
 exercises/practice/leap/leap.nu               |  3 ++
 exercises/practice/leap/tests.nu              | 12 ++++++
 8 files changed, 107 insertions(+)
 create mode 100644 exercises/practice/leap/.docs/instructions.md
 create mode 100644 exercises/practice/leap/.docs/introduction.md
 create mode 100644 exercises/practice/leap/.meta/config.json
 create mode 100644 exercises/practice/leap/.meta/example.nu
 create mode 100644 exercises/practice/leap/.meta/tests.toml
 create mode 100644 exercises/practice/leap/leap.nu
 create mode 100644 exercises/practice/leap/tests.nu

diff --git a/config.json b/config.json
index 3f614c1..77b23f8 100644
--- a/config.json
+++ b/config.json
@@ -165,6 +165,14 @@
         "practices": [],
         "prerequisites": [],
         "difficulty": 2
+      },
+      {
+        "slug": "leap",
+        "name": "Leap",
+        "uuid": "56df31c7-1f94-41d8-b69d-318c2249304e",
+        "practices": [],
+        "prerequisites": [],
+        "difficulty": 1
       }
     ]
   },
diff --git a/exercises/practice/leap/.docs/instructions.md b/exercises/practice/leap/.docs/instructions.md
new file mode 100644
index 0000000..b14f856
--- /dev/null
+++ b/exercises/practice/leap/.docs/instructions.md
@@ -0,0 +1,3 @@
+# Instructions
+
+Your task is to determine whether a given year is a leap year.
diff --git a/exercises/practice/leap/.docs/introduction.md b/exercises/practice/leap/.docs/introduction.md
new file mode 100644
index 0000000..4ffd2da
--- /dev/null
+++ b/exercises/practice/leap/.docs/introduction.md
@@ -0,0 +1,16 @@
+# Introduction
+
+A leap year (in the Gregorian calendar) occurs:
+
+- In every year that is evenly divisible by 4.
+- Unless the year is evenly divisible by 100, in which case it's only a leap year if the year is also evenly divisible by 400.
+
+Some examples:
+
+- 1997 was not a leap year as it's not divisible by 4.
+- 1900 was not a leap year as it's not divisible by 400.
+- 2000 was a leap year!
+
+~~~~exercism/note
+For a delightful, four-minute explanation of the whole phenomenon of leap years, check out [this YouTube video](https://www.youtube.com/watch?v=xX96xng7sAE).
+~~~~
diff --git a/exercises/practice/leap/.meta/config.json b/exercises/practice/leap/.meta/config.json
new file mode 100644
index 0000000..91c82f8
--- /dev/null
+++ b/exercises/practice/leap/.meta/config.json
@@ -0,0 +1,19 @@
+{
+  "authors": [
+    "YanniPapandreou"
+  ],
+  "files": {
+    "solution": [
+      "leap.nu"
+    ],
+    "test": [
+      "tests.nu"
+    ],
+    "example": [
+      ".meta/example.nu"
+    ]
+  },
+  "blurb": "Determine whether a given year is a leap year.",
+  "source": "CodeRanch Cattle Drive, Assignment 3",
+  "source_url": "https://web.archive.org/web/20240907033714/https://coderanch.com/t/718816/Leap"
+}
diff --git a/exercises/practice/leap/.meta/example.nu b/exercises/practice/leap/.meta/example.nu
new file mode 100644
index 0000000..438f584
--- /dev/null
+++ b/exercises/practice/leap/.meta/example.nu
@@ -0,0 +1,9 @@
+export def leapYear [year: int] {
+    if $year mod 4 != 0 {
+        false
+    } else if $year mod 100 != 0 {
+        true
+    } else {
+        $year mod 400 == 0
+    }
+}
diff --git a/exercises/practice/leap/.meta/tests.toml b/exercises/practice/leap/.meta/tests.toml
new file mode 100644
index 0000000..ce6ba32
--- /dev/null
+++ b/exercises/practice/leap/.meta/tests.toml
@@ -0,0 +1,37 @@
+# This is an auto-generated file.
+#
+# Regenerating this file via `configlet sync` will:
+# - Recreate every `description` key/value pair
+# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications
+# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion)
+# - Preserve any other key/value pair
+#
+# As user-added comments (using the # character) will be removed when this file
+# is regenerated, comments can be added via a `comment` key.
+
+[6466b30d-519c-438e-935d-388224ab5223]
+description = "year not divisible by 4 in common year"
+
+[ac227e82-ee82-4a09-9eb6-4f84331ffdb0]
+description = "year divisible by 2, not divisible by 4 in common year"
+
+[4fe9b84c-8e65-489e-970b-856d60b8b78e]
+description = "year divisible by 4, not divisible by 100 in leap year"
+
+[7fc6aed7-e63c-48f5-ae05-5fe182f60a5d]
+description = "year divisible by 4 and 5 is still a leap year"
+
+[78a7848f-9667-4192-ae53-87b30c9a02dd]
+description = "year divisible by 100, not divisible by 400 in common year"
+
+[9d70f938-537c-40a6-ba19-f50739ce8bac]
+description = "year divisible by 100 but not by 3 is still not a leap year"
+
+[42ee56ad-d3e6-48f1-8e3f-c84078d916fc]
+description = "year divisible by 400 is leap year"
+
+[57902c77-6fe9-40de-8302-587b5c27121e]
+description = "year divisible by 400 but not by 125 is still a leap year"
+
+[c30331f6-f9f6-4881-ad38-8ca8c12520c1]
+description = "year divisible by 200, not divisible by 400 in common year"
diff --git a/exercises/practice/leap/leap.nu b/exercises/practice/leap/leap.nu
new file mode 100644
index 0000000..11b2cba
--- /dev/null
+++ b/exercises/practice/leap/leap.nu
@@ -0,0 +1,3 @@
+export def leapYear [year: int] {
+    error make {msg: "Please implement leapYear"}
+}
diff --git a/exercises/practice/leap/tests.nu b/exercises/practice/leap/tests.nu
new file mode 100644
index 0000000..08fcdd7
--- /dev/null
+++ b/exercises/practice/leap/tests.nu
@@ -0,0 +1,12 @@
+use leap.nu leapYear
+use std/assert
+
+assert not (leapYear 2015)
+assert not (leapYear 1970)
+assert (leapYear 1996)
+assert (leapYear 1960)
+assert not (leapYear 2100)
+assert not (leapYear 1900)
+assert (leapYear 2000)
+assert (leapYear 2400)
+assert not (leapYear 1800)

From 3b4e2d3093daba7ab087072a1de983da37ab44ea Mon Sep 17 00:00:00 2001
From: Yanni Papandreou <nepo1y@gmail.com>
Date: Sun, 26 Jul 2026 19:35:55 +0100
Subject: [PATCH 04/14] added raindrops exercise

---
 config.json                                   |  8 +++
 .../practice/raindrops/.docs/instructions.md  | 24 +++++++
 .../practice/raindrops/.docs/introduction.md  |  3 +
 .../practice/raindrops/.meta/config.json      | 19 ++++++
 exercises/practice/raindrops/.meta/example.nu |  9 +++
 exercises/practice/raindrops/.meta/tests.toml | 64 +++++++++++++++++++
 exercises/practice/raindrops/raindrops.nu     |  3 +
 exercises/practice/raindrops/tests.nu         | 39 +++++++++++
 8 files changed, 169 insertions(+)
 create mode 100644 exercises/practice/raindrops/.docs/instructions.md
 create mode 100644 exercises/practice/raindrops/.docs/introduction.md
 create mode 100644 exercises/practice/raindrops/.meta/config.json
 create mode 100644 exercises/practice/raindrops/.meta/example.nu
 create mode 100644 exercises/practice/raindrops/.meta/tests.toml
 create mode 100644 exercises/practice/raindrops/raindrops.nu
 create mode 100644 exercises/practice/raindrops/tests.nu

diff --git a/config.json b/config.json
index 77b23f8..ce4ab1f 100644
--- a/config.json
+++ b/config.json
@@ -173,6 +173,14 @@
         "practices": [],
         "prerequisites": [],
         "difficulty": 1
+      },
+      {
+        "slug": "raindrops",
+        "name": "Raindrops",
+        "uuid": "6373b2e6-4db8-4b3b-b9f6-870b2e0b10a8",
+        "practices": [],
+        "prerequisites": [],
+        "difficulty": 1
       }
     ]
   },
diff --git a/exercises/practice/raindrops/.docs/instructions.md b/exercises/practice/raindrops/.docs/instructions.md
new file mode 100644
index 0000000..df64410
--- /dev/null
+++ b/exercises/practice/raindrops/.docs/instructions.md
@@ -0,0 +1,24 @@
+# Instructions
+
+Your task is to convert a number into its corresponding raindrop sounds.
+
+If a given number:
+
+- is divisible by 3, add "Pling" to the result.
+- is divisible by 5, add "Plang" to the result.
+- is divisible by 7, add "Plong" to the result.
+- **is not** divisible by 3, 5, or 7, the result should be the number as a string.
+
+## Examples
+
+- 28 is divisible by 7, but not 3 or 5, so the result would be `"Plong"`.
+- 30 is divisible by 3 and 5, but not 7, so the result would be `"PlingPlang"`.
+- 34 is not divisible by 3, 5, or 7, so the result would be `"34"`.
+
+~~~~exercism/note
+A common way to test if one number is evenly divisible by another is to compare the [remainder][remainder] or [modulus][modulo] to zero.
+Most languages provide operators or functions for one (or both) of these.
+
+[remainder]: https://exercism.org/docs/programming/operators/remainder
+[modulo]: https://en.wikipedia.org/wiki/Modulo_operation
+~~~~
diff --git a/exercises/practice/raindrops/.docs/introduction.md b/exercises/practice/raindrops/.docs/introduction.md
new file mode 100644
index 0000000..ba12100
--- /dev/null
+++ b/exercises/practice/raindrops/.docs/introduction.md
@@ -0,0 +1,3 @@
+# Introduction
+
+Raindrops is a slightly more complex version of the FizzBuzz challenge, a classic interview question.
diff --git a/exercises/practice/raindrops/.meta/config.json b/exercises/practice/raindrops/.meta/config.json
new file mode 100644
index 0000000..fbbabb9
--- /dev/null
+++ b/exercises/practice/raindrops/.meta/config.json
@@ -0,0 +1,19 @@
+{
+  "authors": [
+    "YanniPapandreou"
+  ],
+  "files": {
+    "solution": [
+      "raindrops.nu"
+    ],
+    "test": [
+      "tests.nu"
+    ],
+    "example": [
+      ".meta/example.nu"
+    ]
+  },
+  "blurb": "Convert a number into its corresponding raindrop sounds - Pling, Plang and Plong.",
+  "source": "A variation on FizzBuzz, a famous technical interview question that is intended to weed out potential candidates. That question is itself derived from Fizz Buzz, a popular children's game for teaching division.",
+  "source_url": "https://en.wikipedia.org/wiki/Fizz_buzz"
+}
diff --git a/exercises/practice/raindrops/.meta/example.nu b/exercises/practice/raindrops/.meta/example.nu
new file mode 100644
index 0000000..2b3102e
--- /dev/null
+++ b/exercises/practice/raindrops/.meta/example.nu
@@ -0,0 +1,9 @@
+export def convert [num: int] {
+    [3 5 7]
+    | zip [Pling Plang Plong]
+    | where {|pair| $num mod $pair.0 == 0}
+    | each {|pair| $pair.1}
+    | if ($in | is-empty) {
+        $num | into string
+    } else { $in | str join }
+}
diff --git a/exercises/practice/raindrops/.meta/tests.toml b/exercises/practice/raindrops/.meta/tests.toml
new file mode 100644
index 0000000..756d16c
--- /dev/null
+++ b/exercises/practice/raindrops/.meta/tests.toml
@@ -0,0 +1,64 @@
+# This is an auto-generated file.
+#
+# Regenerating this file via `configlet sync` will:
+# - Recreate every `description` key/value pair
+# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications
+# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion)
+# - Preserve any other key/value pair
+#
+# As user-added comments (using the # character) will be removed when this file
+# is regenerated, comments can be added via a `comment` key.
+
+[1575d549-e502-46d4-a8e1-6b7bec6123d8]
+description = "the sound for 1 is 1"
+
+[1f51a9f9-4895-4539-b182-d7b0a5ab2913]
+description = "the sound for 3 is Pling"
+
+[2d9bfae5-2b21-4bcd-9629-c8c0e388f3e0]
+description = "the sound for 5 is Plang"
+
+[d7e60daa-32ef-4c23-b688-2abff46c4806]
+description = "the sound for 7 is Plong"
+
+[6bb4947b-a724-430c-923f-f0dc3d62e56a]
+description = "the sound for 6 is Pling as it has a factor 3"
+
+[ce51e0e8-d9d4-446d-9949-96eac4458c2d]
+description = "2 to the power 3 does not make a raindrop sound as 3 is the exponent not the base"
+
+[0dd66175-e3e2-47fc-8750-d01739856671]
+description = "the sound for 9 is Pling as it has a factor 3"
+
+[022c44d3-2182-4471-95d7-c575af225c96]
+description = "the sound for 10 is Plang as it has a factor 5"
+
+[37ab74db-fed3-40ff-b7b9-04acdfea8edf]
+description = "the sound for 14 is Plong as it has a factor of 7"
+
+[31f92999-6afb-40ee-9aa4-6d15e3334d0f]
+description = "the sound for 15 is PlingPlang as it has factors 3 and 5"
+
+[ff9bb95d-6361-4602-be2c-653fe5239b54]
+description = "the sound for 21 is PlingPlong as it has factors 3 and 7"
+
+[d2e75317-b72e-40ab-8a64-6734a21dece1]
+description = "the sound for 25 is Plang as it has a factor 5"
+
+[a09c4c58-c662-4e32-97fe-f1501ef7125c]
+description = "the sound for 27 is Pling as it has a factor 3"
+
+[bdf061de-8564-4899-a843-14b48b722789]
+description = "the sound for 35 is PlangPlong as it has factors 5 and 7"
+
+[c4680bee-69ba-439d-99b5-70c5fd1a7a83]
+description = "the sound for 49 is Plong as it has a factor 7"
+
+[17f2bc9a-b65a-4d23-8ccd-266e8c271444]
+description = "the sound for 52 is 52"
+
+[e46677ed-ff1a-419f-a740-5c713d2830e4]
+description = "the sound for 105 is PlingPlangPlong as it has factors 3, 5 and 7"
+
+[13c6837a-0fcd-4b86-a0eb-20572f7deb0b]
+description = "the sound for 3125 is Plang as it has a factor 5"
diff --git a/exercises/practice/raindrops/raindrops.nu b/exercises/practice/raindrops/raindrops.nu
new file mode 100644
index 0000000..0a908e4
--- /dev/null
+++ b/exercises/practice/raindrops/raindrops.nu
@@ -0,0 +1,3 @@
+export def convert [num: int] {
+    error make {msg: "Please implement convert"}
+}
diff --git a/exercises/practice/raindrops/tests.nu b/exercises/practice/raindrops/tests.nu
new file mode 100644
index 0000000..e29eb95
--- /dev/null
+++ b/exercises/practice/raindrops/tests.nu
@@ -0,0 +1,39 @@
+use raindrops.nu convert
+use std/assert
+
+# the sound for 1 is 1
+assert equal (convert 1) "1"
+# the sound for 3 is Pling
+assert equal (convert 3) "Pling"
+# the sound for 5 is Plang
+assert equal (convert 5) "Plang"
+# the sound for 7 is Plong
+assert equal (convert 7) "Plong"
+# the sound for 6 is Pling as it has a factor 3
+assert equal (convert 6) "Pling"
+# 2 to the power 3 does not make a raindrop sound as 3 is the exponent not the base
+assert equal (convert 8) "8"
+# the sound for 9 is Pling as it has a factor 3
+assert equal (convert 9) "Pling"
+# the sound for 10 is Plang as it has a factor 5
+assert equal (convert 10) "Plang"
+# the sound for 14 is Plong as it has a factor of 7
+assert equal (convert 14) "Plong"
+# the sound for 15 is PlingPlang as it has factors 3 and 5
+assert equal (convert 15) "PlingPlang"
+# the sound for 21 is PlingPlong as it has factors 3 and 7
+assert equal (convert 21) "PlingPlong"
+# the sound for 25 is Plang as it has a factor 5
+assert equal (convert 25) "Plang"
+# the sound for 27 is Pling as it has a factor 3
+assert equal (convert 27) "Pling"
+# the sound for 35 is PlangPlong as it has factors 5 and 7
+assert equal (convert 35) "PlangPlong"
+# the sound for 49 is Plong as it has a factor 7
+assert equal (convert 49) "Plong"
+# the sound for 52 is 52
+assert equal (convert 52) "52"
+# the sound for 105 is PlingPlangPlong as it has factors 3, 5 and 7
+assert equal (convert 105) "PlingPlangPlong"
+# the sound for 3125 is Plang as it has a factor 5
+assert equal (convert 3125) "Plang"

From 964a1a924a80531de820d7e3347c229d2cf9f501 Mon Sep 17 00:00:00 2001
From: Yanni Papandreou <nepo1y@gmail.com>
Date: Sun, 26 Jul 2026 19:36:27 +0100
Subject: [PATCH 05/14] update difficulty

---
 config.json | 2 +-
 1 file changed, 1 insertion(+), 1 deletion(-)

diff --git a/config.json b/config.json
index ce4ab1f..9d258c7 100644
--- a/config.json
+++ b/config.json
@@ -180,7 +180,7 @@
         "uuid": "6373b2e6-4db8-4b3b-b9f6-870b2e0b10a8",
         "practices": [],
         "prerequisites": [],
-        "difficulty": 1
+        "difficulty": 2
       }
     ]
   },

From 4c6dcbb837c2aa53177099105bf5cbb6b98d6cfd Mon Sep 17 00:00:00 2001
From: Yanni Papandreou <nepo1y@gmail.com>
Date: Sun, 26 Jul 2026 21:46:53 +0100
Subject: [PATCH 06/14] added protein-translation exercise

---
 config.json                                   |   8 ++
 .../protein-translation/.docs/instructions.md |  38 +++++++
 .../protein-translation/.meta/config.json     |  18 +++
 .../protein-translation/.meta/example.nu      |  37 ++++++
 .../protein-translation/.meta/tests.toml      | 105 ++++++++++++++++++
 .../protein-translation.nu                    |   3 +
 .../practice/protein-translation/tests.nu     |  65 +++++++++++
 7 files changed, 274 insertions(+)
 create mode 100644 exercises/practice/protein-translation/.docs/instructions.md
 create mode 100644 exercises/practice/protein-translation/.meta/config.json
 create mode 100644 exercises/practice/protein-translation/.meta/example.nu
 create mode 100644 exercises/practice/protein-translation/.meta/tests.toml
 create mode 100644 exercises/practice/protein-translation/protein-translation.nu
 create mode 100644 exercises/practice/protein-translation/tests.nu

diff --git a/config.json b/config.json
index 9d258c7..ca367f8 100644
--- a/config.json
+++ b/config.json
@@ -181,6 +181,14 @@
         "practices": [],
         "prerequisites": [],
         "difficulty": 2
+      },
+      {
+        "slug": "protein-translation",
+        "name": "Protein Translation",
+        "uuid": "061e2ed2-c643-4d1f-9f62-822ef6871cc3",
+        "practices": [],
+        "prerequisites": [],
+        "difficulty": 2
       }
     ]
   },
diff --git a/exercises/practice/protein-translation/.docs/instructions.md b/exercises/practice/protein-translation/.docs/instructions.md
new file mode 100644
index 0000000..35c953b
--- /dev/null
+++ b/exercises/practice/protein-translation/.docs/instructions.md
@@ -0,0 +1,38 @@
+# Instructions
+
+Your job is to translate RNA sequences into proteins.
+
+RNA strands are made up of three-nucleotide sequences called **codons**.
+Each codon translates to an **amino acid**.
+When joined together, those amino acids make a protein.
+
+In the real world, there are 64 codons, which in turn correspond to 20 amino acids.
+However, for this exercise, you’ll only use a few of the possible 64.
+They are listed below:
+
+| Codon              | Amino Acid    |
+| ------------------ | ------------- |
+| AUG                | Methionine    |
+| UUU, UUC           | Phenylalanine |
+| UUA, UUG           | Leucine       |
+| UCU, UCC, UCA, UCG | Serine        |
+| UAU, UAC           | Tyrosine      |
+| UGU, UGC           | Cysteine      |
+| UGG                | Tryptophan    |
+| UAA, UAG, UGA      | STOP          |
+
+For example, the RNA string “AUGUUUUCU” has three codons: “AUG”, “UUU” and “UCU”.
+These map to Methionine, Phenylalanine, and Serine.
+
+## “STOP” Codons
+
+You’ll note from the table above that there are three **“STOP” codons**.
+If you encounter any of these codons, ignore the rest of the sequence — the protein is complete.
+
+For example, “AUGUUUUCUUAAAUG” contains a STOP codon (“UAA”).
+Once we reach that point, we stop processing.
+We therefore only consider the part before it (i.e. “AUGUUUUCU”), not any further codons after it (i.e. “AUG”).
+
+Learn more about [protein translation on Wikipedia][protein-translation].
+
+[protein-translation]: https://en.wikipedia.org/wiki/Translation_(biology)
diff --git a/exercises/practice/protein-translation/.meta/config.json b/exercises/practice/protein-translation/.meta/config.json
new file mode 100644
index 0000000..0097aa4
--- /dev/null
+++ b/exercises/practice/protein-translation/.meta/config.json
@@ -0,0 +1,18 @@
+{
+  "authors": [
+    "YanniPapandreou"
+  ],
+  "files": {
+    "solution": [
+      "protein-translation.nu"
+    ],
+    "test": [
+      "tests.nu"
+    ],
+    "example": [
+      ".meta/example.nu"
+    ]
+  },
+  "blurb": "Translate RNA sequences into proteins.",
+  "source": "Tyler Long"
+}
diff --git a/exercises/practice/protein-translation/.meta/example.nu b/exercises/practice/protein-translation/.meta/example.nu
new file mode 100644
index 0000000..24e0b2a
--- /dev/null
+++ b/exercises/practice/protein-translation/.meta/example.nu
@@ -0,0 +1,37 @@
+def translate [codon: list<string>] {
+    match $codon {
+        [A, U, G] => "Methionine"
+        [U, U, U] | [U, U, C] => "Phenylalanine"
+        [U, U, A] | [U, U, G] => "Leucine"
+        [U, C, U] | [U, C, C] | [U, C, A] | [U, C, G] => "Serine"
+        [U, A, U] | [U, A, C] => "Tyrosine"
+        [U, G, U] | [U, G, C] => "Cysteine"
+        [U, G, G] => "Tryptophan"
+        [U, A, A] | [U, A, G] | [U, G, A] => "STOP"
+        _ => "INVALID"
+    }
+}
+
+export def proteins [strand: string] {
+    let codons = $strand
+    | split chars
+    | chunks 3
+    let n = $codons | length
+    generate {|i|
+        if $i >= $n {
+            return {out: STOP}
+        }
+        let codon = $codons | get $i
+        let translated = translate $codon
+        match $translated {
+            STOP => {out: $translated}
+            INVALID => (error make {msg: "Invalid codon"})
+            _ => {out: $translated, next: ($i + 1)}
+        }
+    } 0
+    | if ($in | last) == STOP {
+        $in | drop 1
+    } else {
+        $in
+    }
+}
diff --git a/exercises/practice/protein-translation/.meta/tests.toml b/exercises/practice/protein-translation/.meta/tests.toml
new file mode 100644
index 0000000..de680e3
--- /dev/null
+++ b/exercises/practice/protein-translation/.meta/tests.toml
@@ -0,0 +1,105 @@
+# This is an auto-generated file.
+#
+# Regenerating this file via `configlet sync` will:
+# - Recreate every `description` key/value pair
+# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications
+# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion)
+# - Preserve any other key/value pair
+#
+# As user-added comments (using the # character) will be removed when this file
+# is regenerated, comments can be added via a `comment` key.
+
+[2c44f7bf-ba20-43f7-a3bf-f2219c0c3f98]
+description = "Empty RNA sequence results in no proteins"
+
+[96d3d44f-34a2-4db4-84cd-fff523e069be]
+description = "Methionine RNA sequence"
+
+[1b4c56d8-d69f-44eb-be0e-7b17546143d9]
+description = "Phenylalanine RNA sequence 1"
+
+[81b53646-bd57-4732-b2cb-6b1880e36d11]
+description = "Phenylalanine RNA sequence 2"
+
+[42f69d4f-19d2-4d2c-a8b0-f0ae9ee1b6b4]
+description = "Leucine RNA sequence 1"
+
+[ac5edadd-08ed-40a3-b2b9-d82bb50424c4]
+description = "Leucine RNA sequence 2"
+
+[8bc36e22-f984-44c3-9f6b-ee5d4e73f120]
+description = "Serine RNA sequence 1"
+
+[5c3fa5da-4268-44e5-9f4b-f016ccf90131]
+description = "Serine RNA sequence 2"
+
+[00579891-b594-42b4-96dc-7ff8bf519606]
+description = "Serine RNA sequence 3"
+
+[08c61c3b-fa34-4950-8c4a-133945570ef6]
+description = "Serine RNA sequence 4"
+
+[54e1e7d8-63c0-456d-91d2-062c72f8eef5]
+description = "Tyrosine RNA sequence 1"
+
+[47bcfba2-9d72-46ad-bbce-22f7666b7eb1]
+description = "Tyrosine RNA sequence 2"
+
+[3a691829-fe72-43a7-8c8e-1bd083163f72]
+description = "Cysteine RNA sequence 1"
+
+[1b6f8a26-ca2f-43b8-8262-3ee446021767]
+description = "Cysteine RNA sequence 2"
+
+[1e91c1eb-02c0-48a0-9e35-168ad0cb5f39]
+description = "Tryptophan RNA sequence"
+
+[e547af0b-aeab-49c7-9f13-801773a73557]
+description = "STOP codon RNA sequence 1"
+
+[67640947-ff02-4f23-a2ef-816f8a2ba72e]
+description = "STOP codon RNA sequence 2"
+
+[9c2ad527-ebc9-4ace-808b-2b6447cb54cb]
+description = "STOP codon RNA sequence 3"
+
+[f4d9d8ee-00a8-47bf-a1e3-1641d4428e54]
+description = "Sequence of two protein codons translates into proteins"
+
+[dd22eef3-b4f1-4ad6-bb0b-27093c090a9d]
+description = "Sequence of two different protein codons translates into proteins"
+
+[d0f295df-fb70-425c-946c-ec2ec185388e]
+description = "Translate RNA strand into correct protein list"
+
+[e30e8505-97ec-4e5f-a73e-5726a1faa1f4]
+description = "Translation stops if STOP codon at beginning of sequence"
+
+[5358a20b-6f4c-4893-bce4-f929001710f3]
+description = "Translation stops if STOP codon at end of two-codon sequence"
+
+[ba16703a-1a55-482f-bb07-b21eef5093a3]
+description = "Translation stops if STOP codon at end of three-codon sequence"
+
+[4089bb5a-d5b4-4e71-b79e-b8d1f14a2911]
+description = "Translation stops if STOP codon in middle of three-codon sequence"
+
+[2c2a2a60-401f-4a80-b977-e0715b23b93d]
+description = "Translation stops if STOP codon in middle of six-codon sequence"
+
+[f6f92714-769f-4187-9524-e353e8a41a80]
+description = "Sequence of two non-STOP codons does not translate to a STOP codon"
+
+[1e75ea2a-f907-4994-ae5c-118632a1cb0f]
+description = "Non-existing codon can't translate"
+include = false
+
+[9eac93f3-627a-4c90-8653-6d0a0595bc6f]
+description = "Unknown amino acids, not part of a codon, can't translate"
+reimplements = "1e75ea2a-f907-4994-ae5c-118632a1cb0f"
+
+[9d73899f-e68e-4291-b1e2-7bf87c00f024]
+description = "Incomplete RNA sequence can't translate"
+
+[43945cf7-9968-402d-ab9f-b8a28750b050]
+description = "Incomplete RNA sequence can translate if valid until a STOP codon"
diff --git a/exercises/practice/protein-translation/protein-translation.nu b/exercises/practice/protein-translation/protein-translation.nu
new file mode 100644
index 0000000..78deba3
--- /dev/null
+++ b/exercises/practice/protein-translation/protein-translation.nu
@@ -0,0 +1,3 @@
+export def proteins [strand: string] {
+    error make {msg: "Please implement proteins"}
+}
diff --git a/exercises/practice/protein-translation/tests.nu b/exercises/practice/protein-translation/tests.nu
new file mode 100644
index 0000000..873e487
--- /dev/null
+++ b/exercises/practice/protein-translation/tests.nu
@@ -0,0 +1,65 @@
+use protein-translation.nu proteins
+use std/assert
+
+# Empty RNA sequence results in no proteins
+assert equal (proteins "") []
+# Methionine RNA sequence
+assert equal (proteins AUG) [Methionine]
+# Phenylalanine RNA sequence 1
+assert equal (proteins UUU) [Phenylalanine]
+# Phenylalanine RNA sequence 2
+assert equal (proteins UUC) [Phenylalanine]
+# Leucine RNA sequence 1
+assert equal (proteins UUA) [Leucine]
+# Leucine RNA sequence 2
+assert equal (proteins UUG) [Leucine]
+# Serine RNA sequence 1
+assert equal (proteins UCU) [Serine]
+# Serine RNA sequence 2
+assert equal (proteins UCC) [Serine]
+# Serine RNA sequence 3
+assert equal (proteins UCA) [Serine]
+# Serine RNA sequence 4
+assert equal (proteins UCG) [Serine]
+# Tyrosine RNA sequence 1
+assert equal (proteins UAU) [Tyrosine]
+# Tyrosine RNA sequence 2
+assert equal (proteins UAC) [Tyrosine]
+# Cysteine RNA sequence 1
+assert equal (proteins UGU) [Cysteine]
+# Cysteine RNA sequence 2
+assert equal (proteins UGC) [Cysteine]
+# Tryptophan RNA sequence
+assert equal (proteins UGG) [Tryptophan]
+# STOP codon RNA sequence 1
+assert equal (proteins UAA) []
+# STOP codon RNA sequence 2
+assert equal (proteins UAG) []
+# STOP codon RNA sequence 3
+assert equal (proteins UGA) []
+# Sequence of two protein codons translates into proteins
+assert equal (proteins UUUUUU) [Phenylalanine, Phenylalanine]
+# Sequence of two different protein codons translates into proteins
+assert equal (proteins UUAUUG) [Leucine, Leucine]
+# Translate RNA strand into correct protein list
+assert equal (proteins AUGUUUUGG) [Methionine, Phenylalanine, Tryptophan]
+# Translation stops if STOP codon at beginning of sequence
+assert equal (proteins UAGUGG) []
+# Translation stops if STOP codon at end of two-codon sequence
+assert equal (proteins UGGUAG) [Tryptophan]
+# Translation stops if STOP codon at end of three-codon sequence
+assert equal (proteins AUGUUUUAA) [Methionine, Phenylalanine]
+# Translation stops if STOP codon in middle of three-codon sequence
+assert equal (proteins UGGUAGUGG) [Tryptophan]
+# Translation stops if STOP codon in middle of six-codon sequence
+assert equal (proteins UGGUGUUAUUAAUGGUUU) [Tryptophan, Cysteine, Tyrosine]
+# Sequence of two non-STOP codons does not translate to a STOP codon
+assert equal (proteins AUGAUG) [Methionine, Methionine]
+# Incomplete RNA sequence can translate if valid until a STOP codon
+assert equal (proteins UUCUUCUAAUGGU) [Phenylalanine, Phenylalanine]
+# Non-existing codon can't translate
+assert error {|| (proteins AAA)}
+# Unknown amino acids, not part of a codon, can't translate
+assert error {|| (proteins XYZ)}
+# Incomplete RNA sequence can't translate
+assert error {|| (proteins AUGU)}

From f70707a98f8343e3ae480225facea4157e3af7cb Mon Sep 17 00:00:00 2001
From: Yanni Papandreou <nepo1y@gmail.com>
Date: Sun, 26 Jul 2026 22:23:06 +0100
Subject: [PATCH 07/14] added grains exercise

---
 config.json                                   |  8 ++++
 .../practice/grains/.docs/instructions.md     | 11 +++++
 .../practice/grains/.docs/introduction.md     |  6 +++
 exercises/practice/grains/.meta/config.json   | 19 ++++++++
 exercises/practice/grains/.meta/example.nu    | 10 +++++
 exercises/practice/grains/.meta/tests.toml    | 43 +++++++++++++++++++
 exercises/practice/grains/grains.nu           |  7 +++
 exercises/practice/grains/tests.nu            | 25 +++++++++++
 8 files changed, 129 insertions(+)
 create mode 100644 exercises/practice/grains/.docs/instructions.md
 create mode 100644 exercises/practice/grains/.docs/introduction.md
 create mode 100644 exercises/practice/grains/.meta/config.json
 create mode 100644 exercises/practice/grains/.meta/example.nu
 create mode 100644 exercises/practice/grains/.meta/tests.toml
 create mode 100644 exercises/practice/grains/grains.nu
 create mode 100644 exercises/practice/grains/tests.nu

diff --git a/config.json b/config.json
index ca367f8..b6b653c 100644
--- a/config.json
+++ b/config.json
@@ -189,6 +189,14 @@
         "practices": [],
         "prerequisites": [],
         "difficulty": 2
+      },
+      {
+        "slug": "grains",
+        "name": "Grains",
+        "uuid": "d6017619-6ef0-4ad2-9d74-1075f7822f21",
+        "practices": [],
+        "prerequisites": [],
+        "difficulty": 1
       }
     ]
   },
diff --git a/exercises/practice/grains/.docs/instructions.md b/exercises/practice/grains/.docs/instructions.md
new file mode 100644
index 0000000..f5b752a
--- /dev/null
+++ b/exercises/practice/grains/.docs/instructions.md
@@ -0,0 +1,11 @@
+# Instructions
+
+Calculate the number of grains of wheat on a chessboard.
+
+A chessboard has 64 squares.
+Square 1 has one grain, square 2 has two grains, square 3 has four grains, and so on, doubling each time.
+
+Write code that calculates:
+
+- the number of grains on a given square
+- the total number of grains on the chessboard
diff --git a/exercises/practice/grains/.docs/introduction.md b/exercises/practice/grains/.docs/introduction.md
new file mode 100644
index 0000000..0df4f46
--- /dev/null
+++ b/exercises/practice/grains/.docs/introduction.md
@@ -0,0 +1,6 @@
+# Introduction
+
+There once was a wise servant who saved the life of a prince.
+The king promised to pay whatever the servant could dream up.
+Knowing that the king loved chess, the servant told the king he would like to have grains of wheat.
+One grain on the first square of a chessboard, with the number of grains doubling on each successive square.
diff --git a/exercises/practice/grains/.meta/config.json b/exercises/practice/grains/.meta/config.json
new file mode 100644
index 0000000..deaeb8a
--- /dev/null
+++ b/exercises/practice/grains/.meta/config.json
@@ -0,0 +1,19 @@
+{
+  "authors": [
+    "YanniPapandreou"
+  ],
+  "files": {
+    "solution": [
+      "grains.nu"
+    ],
+    "test": [
+      "tests.nu"
+    ],
+    "example": [
+      ".meta/example.nu"
+    ]
+  },
+  "blurb": "Calculate the number of grains of wheat on a chessboard given that the number on each square doubles.",
+  "source": "The CodeRanch Cattle Drive, Assignment 6",
+  "source_url": "https://web.archive.org/web/20240908084142/https://coderanch.com/wiki/718824/Grains"
+}
diff --git a/exercises/practice/grains/.meta/example.nu b/exercises/practice/grains/.meta/example.nu
new file mode 100644
index 0000000..b1fb799
--- /dev/null
+++ b/exercises/practice/grains/.meta/example.nu
@@ -0,0 +1,10 @@
+export def square [i: int] {
+    if ($i <= 0) or ($i > 64) {
+        error make {msg: "i must be an integer from 1 to 64"}
+    }
+    2.0 ** ($i - 1)
+}
+
+export def total [] {
+    (2.0 ** 64) - 1
+}
diff --git a/exercises/practice/grains/.meta/tests.toml b/exercises/practice/grains/.meta/tests.toml
new file mode 100644
index 0000000..6ea68bc
--- /dev/null
+++ b/exercises/practice/grains/.meta/tests.toml
@@ -0,0 +1,43 @@
+# This is an auto-generated file.
+#
+# Regenerating this file via `configlet sync` will:
+# - Recreate every `description` key/value pair
+# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications
+# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion)
+# - Preserve any other key/value pair
+#
+# As user-added comments (using the # character) will be removed when this file
+# is regenerated, comments can be added via a `comment` key.
+
+[9fbde8de-36b2-49de-baf2-cd42d6f28405]
+description = "returns the number of grains on the square -> grains on square 1"
+
+[ee1f30c2-01d8-4298-b25d-c677331b5e6d]
+description = "returns the number of grains on the square -> grains on square 2"
+
+[10f45584-2fc3-4875-8ec6-666065d1163b]
+description = "returns the number of grains on the square -> grains on square 3"
+
+[a7cbe01b-36f4-4601-b053-c5f6ae055170]
+description = "returns the number of grains on the square -> grains on square 4"
+
+[c50acc89-8535-44e4-918f-b848ad2817d4]
+description = "returns the number of grains on the square -> grains on square 16"
+
+[acd81b46-c2ad-4951-b848-80d15ed5a04f]
+description = "returns the number of grains on the square -> grains on square 32"
+
+[c73b470a-5efb-4d53-9ac6-c5f6487f227b]
+description = "returns the number of grains on the square -> grains on square 64"
+
+[1d47d832-3e85-4974-9466-5bd35af484e3]
+description = "returns the number of grains on the square -> square 0 is invalid"
+
+[61974483-eeb2-465e-be54-ca5dde366453]
+description = "returns the number of grains on the square -> negative square is invalid"
+
+[a95e4374-f32c-45a7-a10d-ffec475c012f]
+description = "returns the number of grains on the square -> square greater than 64 is invalid"
+
+[6eb07385-3659-4b45-a6be-9dc474222750]
+description = "returns the total number of grains on the board"
diff --git a/exercises/practice/grains/grains.nu b/exercises/practice/grains/grains.nu
new file mode 100644
index 0000000..75b9898
--- /dev/null
+++ b/exercises/practice/grains/grains.nu
@@ -0,0 +1,7 @@
+export def square [i: int] {
+    error make {msg: "Please implement square"}
+}
+
+export def total [] {
+    error make {msg: "Please implement total"}    
+}
diff --git a/exercises/practice/grains/tests.nu b/exercises/practice/grains/tests.nu
new file mode 100644
index 0000000..4203a76
--- /dev/null
+++ b/exercises/practice/grains/tests.nu
@@ -0,0 +1,25 @@
+use grains.nu [square total]
+use std/assert
+
+# grains on square 1
+assert equal (square 1) 1
+# grains on square 2
+assert equal (square 2) 2
+# grains on square 3
+assert equal (square 3) 4
+# grains on square 4
+assert equal (square 4) 8
+# grains on square 16
+assert equal (square 16) 32768
+# grains on square 32
+assert equal (square 32) 2147483648
+# grains on square 64
+assert equal (square 64) 9223372036854775808
+# square 0 is invalid
+assert error {|| (square 0)}
+# negative square is invalid
+assert error {|| (square -1)}
+# square greater than 64 is invalid
+assert error {|| (square 65)}
+# returns the total number of grains on the board
+assert equal (total) 18446744073709551616 

From dd85df98ad87adfde4040aa3598fa147491586d6 Mon Sep 17 00:00:00 2001
From: Yanni Papandreou <nepo1y@gmail.com>
Date: Sun, 26 Jul 2026 22:36:14 +0100
Subject: [PATCH 08/14] implemented gigasecond exercise

---
 config.json                                   |  8 ++++++
 .../practice/gigasecond/.docs/instructions.md |  8 ++++++
 .../practice/gigasecond/.docs/introduction.md | 24 ++++++++++++++++
 .../practice/gigasecond/.meta/config.json     | 19 +++++++++++++
 .../practice/gigasecond/.meta/example.nu      |  3 ++
 .../practice/gigasecond/.meta/tests.toml      | 28 +++++++++++++++++++
 exercises/practice/gigasecond/gigasecond.nu   |  3 ++
 exercises/practice/gigasecond/tests.nu        | 13 +++++++++
 8 files changed, 106 insertions(+)
 create mode 100644 exercises/practice/gigasecond/.docs/instructions.md
 create mode 100644 exercises/practice/gigasecond/.docs/introduction.md
 create mode 100644 exercises/practice/gigasecond/.meta/config.json
 create mode 100644 exercises/practice/gigasecond/.meta/example.nu
 create mode 100644 exercises/practice/gigasecond/.meta/tests.toml
 create mode 100644 exercises/practice/gigasecond/gigasecond.nu
 create mode 100644 exercises/practice/gigasecond/tests.nu

diff --git a/config.json b/config.json
index b6b653c..7fb57da 100644
--- a/config.json
+++ b/config.json
@@ -197,6 +197,14 @@
         "practices": [],
         "prerequisites": [],
         "difficulty": 1
+      },
+      {
+        "slug": "gigasecond",
+        "name": "Gigasecond",
+        "uuid": "1e3400a3-248c-43d8-828c-85db598122dd",
+        "practices": [],
+        "prerequisites": [],
+        "difficulty": 1
       }
     ]
   },
diff --git a/exercises/practice/gigasecond/.docs/instructions.md b/exercises/practice/gigasecond/.docs/instructions.md
new file mode 100644
index 0000000..1e20f00
--- /dev/null
+++ b/exercises/practice/gigasecond/.docs/instructions.md
@@ -0,0 +1,8 @@
+# Instructions
+
+Your task is to determine the date and time one gigasecond after a certain date.
+
+A gigasecond is one thousand million seconds.
+That is a one with nine zeros after it.
+
+If you were born on _January 24th, 2015 at 22:00 (10:00:00pm)_, then you would be a gigasecond old on _October 2nd, 2046 at 23:46:40 (11:46:40pm)_.
diff --git a/exercises/practice/gigasecond/.docs/introduction.md b/exercises/practice/gigasecond/.docs/introduction.md
new file mode 100644
index 0000000..18a3dc2
--- /dev/null
+++ b/exercises/practice/gigasecond/.docs/introduction.md
@@ -0,0 +1,24 @@
+# Introduction
+
+The way we measure time is kind of messy.
+We have 60 seconds in a minute, and 60 minutes in an hour.
+This comes from ancient Babylon, where they used 60 as the basis for their number system.
+We have 24 hours in a day, 7 days in a week, and how many days in a month?
+Well, for days in a month it depends not only on which month it is, but also on what type of calendar is used in the country you live in.
+
+What if, instead, we only use seconds to express time intervals?
+Then we can use metric system prefixes for writing large numbers of seconds in more easily comprehensible quantities.
+
+- A food recipe might explain that you need to let the brownies cook in the oven for two kiloseconds (that's two thousand seconds).
+- Perhaps you and your family would travel to somewhere exotic for two megaseconds (that's two million seconds).
+- And if you and your spouse were married for _a thousand million_ seconds, you would celebrate your one gigasecond anniversary.
+
+~~~~exercism/note
+If we ever colonize Mars or some other planet, measuring time is going to get even messier.
+If someone says "year" do they mean a year on Earth or a year on Mars?
+
+The idea for this exercise came from the science fiction novel ["A Deepness in the Sky"][vinge-novel] by author Vernor Vinge.
+In it the author uses the metric system as the basis for time measurements.
+
+[vinge-novel]: https://www.tor.com/2017/08/03/science-fiction-with-something-for-everyone-a-deepness-in-the-sky-by-vernor-vinge/
+~~~~
diff --git a/exercises/practice/gigasecond/.meta/config.json b/exercises/practice/gigasecond/.meta/config.json
new file mode 100644
index 0000000..adf2bcd
--- /dev/null
+++ b/exercises/practice/gigasecond/.meta/config.json
@@ -0,0 +1,19 @@
+{
+  "authors": [
+    "YanniPapandreou"
+  ],
+  "files": {
+    "solution": [
+      "gigasecond.nu"
+    ],
+    "test": [
+      "tests.nu"
+    ],
+    "example": [
+      ".meta/example.nu"
+    ]
+  },
+  "blurb": "Given a moment, determine the moment that would be after a gigasecond has passed.",
+  "source": "Chapter 9 in Chris Pine's online Learn to Program tutorial.",
+  "source_url": "https://pine.fm/LearnToProgram/chap_09.html"
+}
diff --git a/exercises/practice/gigasecond/.meta/example.nu b/exercises/practice/gigasecond/.meta/example.nu
new file mode 100644
index 0000000..73bf8dd
--- /dev/null
+++ b/exercises/practice/gigasecond/.meta/example.nu
@@ -0,0 +1,3 @@
+export def add [ts: datetime] {
+  $ts + 1_000_000_000sec
+}
diff --git a/exercises/practice/gigasecond/.meta/tests.toml b/exercises/practice/gigasecond/.meta/tests.toml
new file mode 100644
index 0000000..a7caf00
--- /dev/null
+++ b/exercises/practice/gigasecond/.meta/tests.toml
@@ -0,0 +1,28 @@
+# This is an auto-generated file.
+#
+# Regenerating this file via `configlet sync` will:
+# - Recreate every `description` key/value pair
+# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications
+# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion)
+# - Preserve any other key/value pair
+#
+# As user-added comments (using the # character) will be removed when this file
+# is regenerated, comments can be added via a `comment` key.
+
+[92fbe71c-ea52-4fac-bd77-be38023cacf7]
+description = "date only specification of time"
+
+[6d86dd16-6f7a-47be-9e58-bb9fb2ae1433]
+description = "second test for date only specification of time"
+
+[77eb8502-2bca-4d92-89d9-7b39ace28dd5]
+description = "third test for date only specification of time"
+
+[c9d89a7d-06f8-4e28-a305-64f1b2abc693]
+description = "full time specified"
+
+[09d4e30e-728a-4b52-9005-be44a58d9eba]
+description = "full time with day roll-over"
+
+[fcec307c-7529-49ab-b0fe-20309197618a]
+description = "does not mutate the input"
diff --git a/exercises/practice/gigasecond/gigasecond.nu b/exercises/practice/gigasecond/gigasecond.nu
new file mode 100644
index 0000000..83210ab
--- /dev/null
+++ b/exercises/practice/gigasecond/gigasecond.nu
@@ -0,0 +1,3 @@
+export def add [ts: datetime] {
+    error make {msg: "Please implement add"}
+}
diff --git a/exercises/practice/gigasecond/tests.nu b/exercises/practice/gigasecond/tests.nu
new file mode 100644
index 0000000..45796b8
--- /dev/null
+++ b/exercises/practice/gigasecond/tests.nu
@@ -0,0 +1,13 @@
+use gigasecond.nu add
+use std/assert
+
+assert equal (add 2011-04-25) 2043-01-01T01:46:40
+assert equal (add 1977-06-13) 2009-02-19T01:46:40
+assert equal (add 1959-07-19) 1991-03-27T01:46:40
+assert equal (add 2015-01-24T22:00:00) 2046-10-02T23:46:40
+assert equal (add 2015-01-24T23:59:59) 2046-10-03T01:46:39
+
+# test immuatability of input
+let orig_moment = 2015-01-24T23:59:59
+let new_moment = add $orig_moment
+assert equal $orig_moment 2015-01-24T23:59:59

From 0da55c3fbf0539c5c7fd88423dede0a6d3e9c707 Mon Sep 17 00:00:00 2001
From: Yanni Papandreou <nepo1y@gmail.com>
Date: Sun, 26 Jul 2026 23:26:58 +0100
Subject: [PATCH 09/14] implemented meetup exercise

---
 config.json                                   |   8 +
 .../practice/meetup/.docs/instructions.md     |  34 ++
 .../practice/meetup/.docs/introduction.md     |  29 ++
 exercises/practice/meetup/.meta/config.json   |  18 ++
 exercises/practice/meetup/.meta/example.nu    |  46 +++
 exercises/practice/meetup/.meta/tests.toml    | 295 ++++++++++++++++++
 exercises/practice/meetup/meetup.nu           |   8 +
 exercises/practice/meetup/tests.nu            | 193 ++++++++++++
 8 files changed, 631 insertions(+)
 create mode 100644 exercises/practice/meetup/.docs/instructions.md
 create mode 100644 exercises/practice/meetup/.docs/introduction.md
 create mode 100644 exercises/practice/meetup/.meta/config.json
 create mode 100644 exercises/practice/meetup/.meta/example.nu
 create mode 100644 exercises/practice/meetup/.meta/tests.toml
 create mode 100644 exercises/practice/meetup/meetup.nu
 create mode 100644 exercises/practice/meetup/tests.nu

diff --git a/config.json b/config.json
index 7fb57da..e30869c 100644
--- a/config.json
+++ b/config.json
@@ -205,6 +205,14 @@
         "practices": [],
         "prerequisites": [],
         "difficulty": 1
+      },
+      {
+        "slug": "meetup",
+        "name": "Meetup",
+        "uuid": "6712bff7-70a4-4718-b00c-59960b0135ac",
+        "practices": [],
+        "prerequisites": [],
+        "difficulty": 2
       }
     ]
   },
diff --git a/exercises/practice/meetup/.docs/instructions.md b/exercises/practice/meetup/.docs/instructions.md
new file mode 100644
index 0000000..8b1bda5
--- /dev/null
+++ b/exercises/practice/meetup/.docs/instructions.md
@@ -0,0 +1,34 @@
+# Instructions
+
+Your task is to find the exact date of a meetup, given a month, year, weekday and week.
+
+There are six week values to consider: `first`, `second`, `third`, `fourth`, `last`, `teenth`.
+
+For example, you might be asked to find the date for the meetup on the first Monday in January 2018 (January 1, 2018).
+
+Similarly, you might be asked to find:
+
+- the third Tuesday of August 2019 (August 20, 2019)
+- the teenth Wednesday of May 2020 (May 13, 2020)
+- the fourth Sunday of July 2021 (July 25, 2021)
+- the last Thursday of November 2022 (November 24, 2022)
+- the teenth Saturday of August 1953 (August 15, 1953)
+
+## Teenth
+
+The teenth week refers to the seven days in a month that end in '-teenth' (13th, 14th, 15th, 16th, 17th, 18th and 19th).
+
+If asked to find the teenth Saturday of August, 1953, we check its calendar:
+
+```plaintext
+    August 1953
+Su Mo Tu We Th Fr Sa
+                   1
+ 2  3  4  5  6  7  8
+ 9 10 11 12 13 14 15
+16 17 18 19 20 21 22
+23 24 25 26 27 28 29
+30 31
+```
+
+From this we find that the teenth Saturday is August 15, 1953.
diff --git a/exercises/practice/meetup/.docs/introduction.md b/exercises/practice/meetup/.docs/introduction.md
new file mode 100644
index 0000000..29170ef
--- /dev/null
+++ b/exercises/practice/meetup/.docs/introduction.md
@@ -0,0 +1,29 @@
+# Introduction
+
+Every month, your partner meets up with their best friend.
+Both of them have very busy schedules, making it challenging to find a suitable date!
+Given your own busy schedule, your partner always double-checks potential meetup dates with you:
+
+- "Can I meet up on the first Friday of next month?"
+- "What about the third Wednesday?"
+- "Maybe the last Sunday?"
+
+In this month's call, your partner asked you this question:
+
+- "I'd like to meet up on the teenth Thursday; is that okay?"
+
+Confused, you ask what a "teenth" day is.
+Your partner explains that a teenth day, a concept they made up, refers to the days in a month that end in '-teenth':
+
+- 13th (thirteenth)
+- 14th (fourteenth)
+- 15th (fifteenth)
+- 16th (sixteenth)
+- 17th (seventeenth)
+- 18th (eighteenth)
+- 19th (nineteenth)
+
+As there are also seven weekdays, it is guaranteed that each day of the week has _exactly one_ teenth day each month.
+
+Now that you understand the concept of a teenth day, you check your calendar.
+You don't have anything planned on the teenth Thursday, so you happily confirm the date with your partner.
diff --git a/exercises/practice/meetup/.meta/config.json b/exercises/practice/meetup/.meta/config.json
new file mode 100644
index 0000000..0047ddd
--- /dev/null
+++ b/exercises/practice/meetup/.meta/config.json
@@ -0,0 +1,18 @@
+{
+  "authors": [
+    "YanniPapandreou"
+  ],
+  "files": {
+    "solution": [
+      "meetup.nu"
+    ],
+    "test": [
+      "tests.nu"
+    ],
+    "example": [
+      ".meta/example.nu"
+    ]
+  },
+  "blurb": "Calculate the date of meetups.",
+  "source": "Jeremy Hinegardner mentioned a Boulder meetup that happens on the Wednesteenth of every month"
+}
diff --git a/exercises/practice/meetup/.meta/example.nu b/exercises/practice/meetup/.meta/example.nu
new file mode 100644
index 0000000..ce42f0a
--- /dev/null
+++ b/exercises/practice/meetup/.meta/example.nu
@@ -0,0 +1,46 @@
+def convert_day_of_week [dayofweek: string] {
+    match ($dayofweek | str lowercase) {
+        sunday => "su"
+        monday => "mo"
+        tuesday => "tu"
+        wednesday => "we"
+        thursday => "th"
+        friday => "fr"
+        saturday => "sa"
+        _ => (error make {msg: "invalid day of week"})
+    }
+}
+
+def format_val [val: int] {
+    $val
+    | fill -a right -c '0' -w 2
+}
+
+export def main [
+    year: int
+    month: int
+    week: string
+    dayofweek: string
+] {
+    let possible_days = cal --as-table --full-year $year --month
+    | where month == $month
+    | get (convert_day_of_week $dayofweek)
+    | where {|x| $x | is-not-empty}
+    let day = match $week {
+        first => ($possible_days | get 0)
+        second => ($possible_days | get 1)
+        third => ($possible_days | get 2)
+        fourth => ($possible_days | get 3)
+        last => ($possible_days | last)
+        teenth => ($possible_days | intersect [
+            13
+            14
+            15
+            16
+            17
+            18
+            19
+        ] | first)
+    }
+    $"($year)-(format_val $month)-(format_val $day)"
+}
diff --git a/exercises/practice/meetup/.meta/tests.toml b/exercises/practice/meetup/.meta/tests.toml
new file mode 100644
index 0000000..1e5b84d
--- /dev/null
+++ b/exercises/practice/meetup/.meta/tests.toml
@@ -0,0 +1,295 @@
+# This is an auto-generated file.
+#
+# Regenerating this file via `configlet sync` will:
+# - Recreate every `description` key/value pair
+# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications
+# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion)
+# - Preserve any other key/value pair
+#
+# As user-added comments (using the # character) will be removed when this file
+# is regenerated, comments can be added via a `comment` key.
+
+[d7f8eadd-d4fc-46ee-8a20-e97bd3fd01c8]
+description = "when teenth Monday is the 13th, the first day of the teenth week"
+
+[f78373d1-cd53-4a7f-9d37-e15bf8a456b4]
+description = "when teenth Monday is the 19th, the last day of the teenth week"
+
+[8c78bea7-a116-425b-9c6b-c9898266d92a]
+description = "when teenth Monday is some day in the middle of the teenth week"
+
+[cfef881b-9dc9-4d0b-8de4-82d0f39fc271]
+description = "when teenth Tuesday is the 19th, the last day of the teenth week"
+
+[69048961-3b00-41f9-97ee-eb6d83a8e92b]
+description = "when teenth Tuesday is some day in the middle of the teenth week"
+
+[d30bade8-3622-466a-b7be-587414e0caa6]
+description = "when teenth Tuesday is the 13th, the first day of the teenth week"
+
+[8db4b58b-92f3-4687-867b-82ee1a04f851]
+description = "when teenth Wednesday is some day in the middle of the teenth week"
+
+[6c27a2a2-28f8-487f-ae81-35d08c4664f7]
+description = "when teenth Wednesday is the 13th, the first day of the teenth week"
+
+[008a8674-1958-45b5-b8e6-c2c9960d973a]
+description = "when teenth Wednesday is the 19th, the last day of the teenth week"
+
+[e4abd5e3-57cb-4091-8420-d97e955c0dbd]
+description = "when teenth Thursday is some day in the middle of the teenth week"
+
+[85da0b0f-eace-4297-a6dd-63588d5055b4]
+description = "when teenth Thursday is the 13th, the first day of the teenth week"
+
+[ecf64f9b-8413-489b-bf6e-128045f70bcc]
+description = "when teenth Thursday is the 19th, the last day of the teenth week"
+
+[ac4e180c-7d0a-4d3d-b05f-f564ebb584ca]
+description = "when teenth Friday is the 19th, the last day of the teenth week"
+
+[b79101c7-83ad-4f8f-8ec8-591683296315]
+description = "when teenth Friday is some day in the middle of the teenth week"
+
+[6ed38b9f-0072-4901-bd97-7c8b8b0ef1b8]
+description = "when teenth Friday is the 13th, the first day of the teenth week"
+
+[dfae03ed-9610-47de-a632-655ab01e1e7c]
+description = "when teenth Saturday is some day in the middle of the teenth week"
+
+[ec02e3e1-fc72-4a3c-872f-a53fa8ab358e]
+description = "when teenth Saturday is the 13th, the first day of the teenth week"
+
+[d983094b-7259-4195-b84e-5d09578c89d9]
+description = "when teenth Saturday is the 19th, the last day of the teenth week"
+
+[d84a2a2e-f745-443a-9368-30051be60c2e]
+description = "when teenth Sunday is the 19th, the last day of the teenth week"
+
+[0e64bc53-92a3-4f61-85b2-0b7168c7ce5a]
+description = "when teenth Sunday is some day in the middle of the teenth week"
+
+[de87652c-185e-4854-b3ae-04cf6150eead]
+description = "when teenth Sunday is the 13th, the first day of the teenth week"
+
+[2cbfd0f5-ba3a-46da-a8cc-0fe4966d3411]
+description = "when first Monday is some day in the middle of the first week"
+
+[a6168c7c-ed95-4bb3-8f92-c72575fc64b0]
+description = "when first Monday is the 1st, the first day of the first week"
+
+[1bfc620f-1c54-4bbd-931f-4a1cd1036c20]
+description = "when first Tuesday is the 7th, the last day of the first week"
+
+[12959c10-7362-4ca0-a048-50cf1c06e3e2]
+description = "when first Tuesday is some day in the middle of the first week"
+
+[1033dc66-8d0b-48a1-90cb-270703d59d1d]
+description = "when first Wednesday is some day in the middle of the first week"
+
+[b89185b9-2f32-46f4-a602-de20b09058f6]
+description = "when first Wednesday is the 7th, the last day of the first week"
+
+[53aedc4d-b2c8-4dfb-abf7-a8dc9cdceed5]
+description = "when first Thursday is some day in the middle of the first week"
+
+[b420a7e3-a94c-4226-870a-9eb3a92647f0]
+description = "when first Thursday is another day in the middle of the first week"
+
+[61df3270-28b4-4713-bee2-566fa27302ca]
+description = "when first Friday is the 1st, the first day of the first week"
+
+[cad33d4d-595c-412f-85cf-3874c6e07abf]
+description = "when first Friday is some day in the middle of the first week"
+
+[a2869b52-5bba-44f0-a863-07bd1f67eadb]
+description = "when first Saturday is some day in the middle of the first week"
+
+[3585315a-d0db-4ea1-822e-0f22e2a645f5]
+description = "when first Saturday is another day in the middle of the first week"
+
+[c49e9bd9-8ccf-4cf2-947a-0ccd4e4f10b1]
+description = "when first Sunday is some day in the middle of the first week"
+
+[1513328b-df53-4714-8677-df68c4f9366c]
+description = "when first Sunday is the 7th, the last day of the first week"
+
+[49e083af-47ec-4018-b807-62ef411efed7]
+description = "when second Monday is some day in the middle of the second week"
+
+[6cb79a73-38fe-4475-9101-9eec36cf79e5]
+description = "when second Monday is the 8th, the first day of the second week"
+
+[4c39b594-af7e-4445-aa03-bf4f8effd9a1]
+description = "when second Tuesday is the 14th, the last day of the second week"
+
+[41b32c34-2e39-40e3-b790-93539aaeb6dd]
+description = "when second Tuesday is some day in the middle of the second week"
+
+[90a160c5-b5d9-4831-927f-63a78b17843d]
+description = "when second Wednesday is some day in the middle of the second week"
+
+[23b98ce7-8dd5-41a1-9310-ef27209741cb]
+description = "when second Wednesday is the 14th, the last day of the second week"
+
+[447f1960-27ca-4729-bc3f-f36043f43ed0]
+description = "when second Thursday is some day in the middle of the second week"
+
+[c9aa2687-300c-4e79-86ca-077849a81bde]
+description = "when second Thursday is another day in the middle of the second week"
+
+[a7e11ef3-6625-4134-acda-3e7195421c09]
+description = "when second Friday is the 8th, the first day of the second week"
+
+[8b420e5f-9290-4106-b5ae-022f3e2a3e41]
+description = "when second Friday is some day in the middle of the second week"
+
+[80631afc-fc11-4546-8b5f-c12aaeb72b4f]
+description = "when second Saturday is some day in the middle of the second week"
+
+[e34d43ac-f470-44c2-aa5f-e97b78ecaf83]
+description = "when second Saturday is another day in the middle of the second week"
+
+[a57d59fd-1023-47ad-b0df-a6feb21b44fc]
+description = "when second Sunday is some day in the middle of the second week"
+
+[a829a8b0-abdd-4ad1-b66c-5560d843c91a]
+description = "when second Sunday is the 14th, the last day of the second week"
+
+[501a8a77-6038-4fc0-b74c-33634906c29d]
+description = "when third Monday is some day in the middle of the third week"
+
+[49e4516e-cf32-4a58-8bbc-494b7e851c92]
+description = "when third Monday is the 15th, the first day of the third week"
+
+[4db61095-f7c7-493c-85f1-9996ad3012c7]
+description = "when third Tuesday is the 21st, the last day of the third week"
+
+[714fc2e3-58d0-4b91-90fd-61eefd2892c0]
+description = "when third Tuesday is some day in the middle of the third week"
+
+[b08a051a-2c80-445b-9b0e-524171a166d1]
+description = "when third Wednesday is some day in the middle of the third week"
+
+[80bb9eff-3905-4c61-8dc9-bb03016d8ff8]
+description = "when third Wednesday is the 21st, the last day of the third week"
+
+[fa52a299-f77f-4784-b290-ba9189fbd9c9]
+description = "when third Thursday is some day in the middle of the third week"
+
+[f74b1bc6-cc5c-4bf1-ba69-c554a969eb38]
+description = "when third Thursday is another day in the middle of the third week"
+
+[8900f3b0-801a-466b-a866-f42d64667abd]
+description = "when third Friday is the 15th, the first day of the third week"
+
+[538ac405-a091-4314-9ccd-920c4e38e85e]
+description = "when third Friday is some day in the middle of the third week"
+
+[244db35c-2716-4fa0-88ce-afd58e5cf910]
+description = "when third Saturday is some day in the middle of the third week"
+
+[dd28544f-f8fa-4f06-9bcd-0ad46ce68e9e]
+description = "when third Saturday is another day in the middle of the third week"
+
+[be71dcc6-00d2-4b53-a369-cbfae55b312f]
+description = "when third Sunday is some day in the middle of the third week"
+
+[b7d2da84-4290-4ee6-a618-ee124ae78be7]
+description = "when third Sunday is the 21st, the last day of the third week"
+
+[4276dc06-a1bd-4fc2-b6c2-625fee90bc88]
+description = "when fourth Monday is some day in the middle of the fourth week"
+
+[ddbd7976-2deb-4250-8a38-925ac1a8e9a2]
+description = "when fourth Monday is the 22nd, the first day of the fourth week"
+
+[eb714ef4-1656-47cc-913c-844dba4ebddd]
+description = "when fourth Tuesday is the 28th, the last day of the fourth week"
+
+[16648435-7937-4d2d-b118-c3e38fd084bd]
+description = "when fourth Tuesday is some day in the middle of the fourth week"
+
+[de062bdc-9484-437a-a8c5-5253c6f6785a]
+description = "when fourth Wednesday is some day in the middle of the fourth week"
+
+[c2ce6821-169c-4832-8d37-690ef5d9514a]
+description = "when fourth Wednesday is the 28th, the last day of the fourth week"
+
+[d462c631-2894-4391-a8e3-dbb98b7a7303]
+description = "when fourth Thursday is some day in the middle of the fourth week"
+
+[9ff1f7b6-1b72-427d-9ee9-82b5bb08b835]
+description = "when fourth Thursday is another day in the middle of the fourth week"
+
+[83bae8ba-1c49-49bc-b632-b7c7e1d7e35f]
+description = "when fourth Friday is the 22nd, the first day of the fourth week"
+
+[de752d2a-a95e-48d2-835b-93363dac3710]
+description = "when fourth Friday is some day in the middle of the fourth week"
+
+[eedd90ad-d581-45db-8312-4c6dcf9cf560]
+description = "when fourth Saturday is some day in the middle of the fourth week"
+
+[669fedcd-912e-48c7-a0a1-228b34af91d0]
+description = "when fourth Saturday is another day in the middle of the fourth week"
+
+[648e3849-ea49-44a5-a8a3-9f2a43b3bf1b]
+description = "when fourth Sunday is some day in the middle of the fourth week"
+
+[f81321b3-99ab-4db6-9267-69c5da5a7823]
+description = "when fourth Sunday is the 28th, the last day of the fourth week"
+
+[1af5e51f-5488-4548-aee8-11d7d4a730dc]
+description = "last Monday in a month with four Mondays"
+
+[f29999f2-235e-4ec7-9dab-26f137146526]
+description = "last Monday in a month with five Mondays"
+
+[31b097a0-508e-48ac-bf8a-f63cdcf6dc41]
+description = "last Tuesday in a month with four Tuesdays"
+
+[8c022150-0bb5-4a1f-80f9-88b2e2abcba4]
+description = "last Tuesday in another month with four Tuesdays"
+
+[0e762194-672a-4bdf-8a37-1e59fdacef12]
+description = "last Wednesday in a month with five Wednesdays"
+
+[5016386a-f24e-4bd7-b439-95358f491b66]
+description = "last Wednesday in a month with four Wednesdays"
+
+[12ead1a5-cdf9-4192-9a56-2229e93dd149]
+description = "last Thursday in a month with four Thursdays"
+
+[7db89e11-7fbe-4e57-ae3c-0f327fbd7cc7]
+description = "last Thursday in a month with five Thursdays"
+
+[e47a739e-b979-460d-9c8a-75c35ca2290b]
+description = "last Friday in a month with five Fridays"
+
+[5bed5aa9-a57a-4e5d-8997-2cc796a5b0ec]
+description = "last Friday in a month with four Fridays"
+
+[61e54cba-76f3-4772-a2b1-bf443fda2137]
+description = "last Saturday in a month with four Saturdays"
+
+[8b6a737b-2fa9-444c-b1a2-80ce7a2ec72f]
+description = "last Saturday in another month with four Saturdays"
+
+[0b63e682-f429-4d19-9809-4a45bd0242dc]
+description = "last Sunday in a month with five Sundays"
+
+[5232307e-d3e3-4afc-8ba6-4084ad987c00]
+description = "last Sunday in a month with four Sundays"
+
+[0bbd48e8-9773-4e81-8e71-b9a51711e3c5]
+description = "when last Wednesday in February in a leap year is the 29th"
+
+[fe0936de-7eee-4a48-88dd-66c07ab1fefc]
+description = "last Wednesday in December that is also the last day of the year"
+
+[2ccf2488-aafc-4671-a24e-2b6effe1b0e2]
+description = "when last Sunday in February in a non-leap year is not the 29th"
+
+[00c3ce9f-cf36-4b70-90d8-92b32be6830e]
+description = "when first Friday is the 7th, the last day of the first week"
diff --git a/exercises/practice/meetup/meetup.nu b/exercises/practice/meetup/meetup.nu
new file mode 100644
index 0000000..138b7b5
--- /dev/null
+++ b/exercises/practice/meetup/meetup.nu
@@ -0,0 +1,8 @@
+export def main [
+    year: int
+    month: int
+    week: string
+    dayofweek: string
+] {
+    error make {msg: "Please implement meetup"}
+}
diff --git a/exercises/practice/meetup/tests.nu b/exercises/practice/meetup/tests.nu
new file mode 100644
index 0000000..432f2dd
--- /dev/null
+++ b/exercises/practice/meetup/tests.nu
@@ -0,0 +1,193 @@
+use meetup.nu
+use std/assert
+
+# when teenth Monday is the 13th, the first day of the teenth week
+assert equal (meetup 2013 5 teenth Monday) "2013-05-13"
+# when teenth Monday is the 19th, the last day of the teenth week
+assert equal (meetup 2013 8 teenth Monday) "2013-08-19"
+# when teenth Monday is some day in the middle of the teenth week
+assert equal (meetup 2013 9 teenth Monday) "2013-09-16"
+# when teenth Tuesday is the 19th, the last day of the teenth week
+assert equal (meetup 2013 3 teenth Tuesday) "2013-03-19"
+# when teenth Tuesday is some day in the middle of the teenth week
+assert equal (meetup 2013 4 teenth Tuesday) "2013-04-16"
+# when teenth Tuesday is the 13th, the first day of the teenth week
+assert equal (meetup 2013 8 teenth Tuesday) "2013-08-13"
+# when teenth Wednesday is some day in the middle of the teenth week
+assert equal (meetup 2013 1 teenth Wednesday) "2013-01-16"
+# when teenth Wednesday is the 13th, the first day of the teenth week
+assert equal (meetup 2013 2 teenth Wednesday) "2013-02-13"
+# when teenth Wednesday is the 19th, the last day of the teenth week
+assert equal (meetup 2013 6 teenth Wednesday) "2013-06-19"
+# when teenth Thursday is some day in the middle of the teenth week
+assert equal (meetup 2013 5 teenth Thursday) "2013-05-16"
+# when teenth Thursday is the 13th, the first day of the teenth week
+assert equal (meetup 2013 6 teenth Thursday) "2013-06-13"
+# when teenth Thursday is the 19th, the last day of the teenth week
+assert equal (meetup 2013 9 teenth Thursday) "2013-09-19"
+# when teenth Friday is the 19th, the last day of the teenth week
+assert equal (meetup 2013 4 teenth Friday) "2013-04-19"
+# when teenth Friday is some day in the middle of the teenth week
+assert equal (meetup 2013 8 teenth Friday) "2013-08-16"
+# when teenth Friday is the 13th, the first day of the teenth week
+assert equal (meetup 2013 9 teenth Friday) "2013-09-13"
+# when teenth Saturday is some day in the middle of the teenth week
+assert equal (meetup 2013 2 teenth Saturday) "2013-02-16"
+# when teenth Saturday is the 13th, the first day of the teenth week
+assert equal (meetup 2013 4 teenth Saturday) "2013-04-13"
+# when teenth Saturday is the 19th, the last day of the teenth week
+assert equal (meetup 2013 10 teenth Saturday) "2013-10-19"
+# when teenth Sunday is the 19th, the last day of the teenth week
+assert equal (meetup 2013 5 teenth Sunday) "2013-05-19"
+# when teenth Sunday is some day in the middle of the teenth week
+assert equal (meetup 2013 6 teenth Sunday) "2013-06-16"
+# when teenth Sunday is the 13th, the first day of the teenth week
+assert equal (meetup 2013 10 teenth Sunday) "2013-10-13"
+# when first Monday is some day in the middle of the first week
+assert equal (meetup 2013 3 first Monday) "2013-03-04"
+# when first Monday is the 1st, the first day of the first week
+assert equal (meetup 2013 4 first Monday) "2013-04-01"
+# when first Tuesday is the 7th, the last day of the first week
+assert equal (meetup 2013 5 first Tuesday) "2013-05-07"
+# when first Tuesday is some day in the middle of the first week
+assert equal (meetup 2013 6 first Tuesday) "2013-06-04"
+# when first Wednesday is some day in the middle of the first week
+assert equal (meetup 2013 7 first Wednesday) "2013-07-03"
+# when first Wednesday is the 7th, the last day of the first week
+assert equal (meetup 2013 8 first Wednesday) "2013-08-07"
+# when first Thursday is some day in the middle of the first week
+assert equal (meetup 2013 9 first Thursday) "2013-09-05"
+# when first Thursday is another day in the middle of the first week
+assert equal (meetup 2013 10 first Thursday) "2013-10-03"
+# when first Friday is the 1st, the first day of the first week
+assert equal (meetup 2013 11 first Friday) "2013-11-01"
+# when first Friday is some day in the middle of the first week
+assert equal (meetup 2013 12 first Friday) "2013-12-06"
+# when first Saturday is some day in the middle of the first week
+assert equal (meetup 2013 1 first Saturday) "2013-01-05"
+# when first Saturday is another day in the middle of the first week
+assert equal (meetup 2013 2 first Saturday) "2013-02-02"
+# when first Sunday is some day in the middle of the first week
+assert equal (meetup 2013 3 first Sunday) "2013-03-03"
+# when first Sunday is the 7th, the last day of the first week
+assert equal (meetup 2013 4 first Sunday) "2013-04-07"
+# when second Monday is some day in the middle of the second week
+assert equal (meetup 2013 3 second Monday) "2013-03-11"
+# when second Monday is the 8th, the first day of the second week
+assert equal (meetup 2013 4 second Monday) "2013-04-08"
+# when second Tuesday is the 14th, the last day of the second week
+assert equal (meetup 2013 5 second Tuesday) "2013-05-14"
+# when second Tuesday is some day in the middle of the second week
+assert equal (meetup 2013 6 second Tuesday) "2013-06-11"
+# when second Wednesday is some day in the middle of the second week
+assert equal (meetup 2013 7 second Wednesday) "2013-07-10"
+# when second Wednesday is the 14th, the last day of the second week
+assert equal (meetup 2013 8 second Wednesday) "2013-08-14"
+# when second Thursday is some day in the middle of the second week
+assert equal (meetup 2013 9 second Thursday) "2013-09-12"
+# when second Thursday is another day in the middle of the second week
+assert equal (meetup 2013 10 second Thursday) "2013-10-10"
+# when second Friday is the 8th, the first day of the second week
+assert equal (meetup 2013 11 second Friday) "2013-11-08"
+# when second Friday is some day in the middle of the second week
+assert equal (meetup 2013 12 second Friday) "2013-12-13"
+# when second Saturday is some day in the middle of the second week
+assert equal (meetup 2013 1 second Saturday) "2013-01-12"
+# when second Saturday is another day in the middle of the second week
+assert equal (meetup 2013 2 second Saturday) "2013-02-09"
+# when second Sunday is some day in the middle of the second week
+assert equal (meetup 2013 3 second Sunday) "2013-03-10"
+# when second Sunday is the 14th, the last day of the second week
+assert equal (meetup 2013 4 second Sunday) "2013-04-14"
+# when third Monday is some day in the middle of the third week
+assert equal (meetup 2013 3 third Monday) "2013-03-18"
+# when third Monday is the 15th, the first day of the third week
+assert equal (meetup 2013 4 third Monday) "2013-04-15"
+# when third Tuesday is the 21st, the last day of the third week
+assert equal (meetup 2013 5 third Tuesday) "2013-05-21"
+# when third Tuesday is some day in the middle of the third week
+assert equal (meetup 2013 6 third Tuesday) "2013-06-18"
+# when third Wednesday is some day in the middle of the third week
+assert equal (meetup 2013 7 third Wednesday) "2013-07-17"
+# when third Wednesday is the 21st, the last day of the third week
+assert equal (meetup 2013 8 third Wednesday) "2013-08-21"
+# when third Thursday is some day in the middle of the third week
+assert equal (meetup 2013 9 third Thursday) "2013-09-19"
+# when third Thursday is another day in the middle of the third week
+assert equal (meetup 2013 10 third Thursday) "2013-10-17"
+# when third Friday is the 15th, the first day of the third week
+assert equal (meetup 2013 11 third Friday) "2013-11-15"
+# when third Friday is some day in the middle of the third week
+assert equal (meetup 2013 12 third Friday) "2013-12-20"
+# when third Saturday is some day in the middle of the third week
+assert equal (meetup 2013 1 third Saturday) "2013-01-19"
+# when third Saturday is another day in the middle of the third week
+assert equal (meetup 2013 2 third Saturday) "2013-02-16"
+# when third Sunday is some day in the middle of the third week
+assert equal (meetup 2013 3 third Sunday) "2013-03-17"
+# when third Sunday is the 21st, the last day of the third week
+assert equal (meetup 2013 4 third Sunday) "2013-04-21"
+# when fourth Monday is some day in the middle of the fourth week
+assert equal (meetup 2013 3 fourth Monday) "2013-03-25"
+# when fourth Monday is the 22nd, the first day of the fourth week
+assert equal (meetup 2013 4 fourth Monday) "2013-04-22"
+# when fourth Tuesday is the 28th, the last day of the fourth week
+assert equal (meetup 2013 5 fourth Tuesday) "2013-05-28"
+# when fourth Tuesday is some day in the middle of the fourth week
+assert equal (meetup 2013 6 fourth Tuesday) "2013-06-25"
+# when fourth Wednesday is some day in the middle of the fourth week
+assert equal (meetup 2013 7 fourth Wednesday) "2013-07-24"
+# when fourth Wednesday is the 28th, the last day of the fourth week
+assert equal (meetup 2013 8 fourth Wednesday) "2013-08-28"
+# when fourth Thursday is some day in the middle of the fourth week
+assert equal (meetup 2013 9 fourth Thursday) "2013-09-26"
+# when fourth Thursday is another day in the middle of the fourth week
+assert equal (meetup 2013 10 fourth Thursday) "2013-10-24"
+# when fourth Friday is the 22nd, the first day of the fourth week
+assert equal (meetup 2013 11 fourth Friday) "2013-11-22"
+# when fourth Friday is some day in the middle of the fourth week
+assert equal (meetup 2013 12 fourth Friday) "2013-12-27"
+# when fourth Saturday is some day in the middle of the fourth week
+assert equal (meetup 2013 1 fourth Saturday) "2013-01-26"
+# when fourth Saturday is another day in the middle of the fourth week
+assert equal (meetup 2013 2 fourth Saturday) "2013-02-23"
+# when fourth Sunday is some day in the middle of the fourth week
+assert equal (meetup 2013 3 fourth Sunday) "2013-03-24"
+# when fourth Sunday is the 28th, the last day of the fourth week
+assert equal (meetup 2013 4 fourth Sunday) "2013-04-28"
+# last Monday in a month with four Mondays
+assert equal (meetup 2013 3 last Monday) "2013-03-25"
+# last Monday in a month with five Mondays
+assert equal (meetup 2013 4 last Monday) "2013-04-29"
+# last Tuesday in a month with four Tuesdays
+assert equal (meetup 2013 5 last Tuesday) "2013-05-28"
+# last Tuesday in another month with four Tuesdays
+assert equal (meetup 2013 6 last Tuesday) "2013-06-25"
+# last Wednesday in a month with five Wednesdays
+assert equal (meetup 2013 7 last Wednesday) "2013-07-31"
+# last Wednesday in a month with four Wednesdays
+assert equal (meetup 2013 8 last Wednesday) "2013-08-28"
+# last Thursday in a month with four Thursdays
+assert equal (meetup 2013 9 last Thursday) "2013-09-26"
+# last Thursday in a month with five Thursdays
+assert equal (meetup 2013 10 last Thursday) "2013-10-31"
+# last Friday in a month with five Fridays
+assert equal (meetup 2013 11 last Friday) "2013-11-29"
+# last Friday in a month with four Fridays
+assert equal (meetup 2013 12 last Friday) "2013-12-27"
+# last Saturday in a month with four Saturdays
+assert equal (meetup 2013 1 last Saturday) "2013-01-26"
+# last Saturday in another month with four Saturdays
+assert equal (meetup 2013 2 last Saturday) "2013-02-23"
+# last Sunday in a month with five Sundays
+assert equal (meetup 2013 3 last Sunday) "2013-03-31"
+# last Sunday in a month with four Sundays
+assert equal (meetup 2013 4 last Sunday) "2013-04-28"
+# when last Wednesday in February in a leap year is the 29th
+assert equal (meetup 2012 2 last Wednesday) "2012-02-29"
+# last Wednesday in December that is also the last day of the year
+assert equal (meetup 2014 12 last Wednesday) "2014-12-31"
+# when last Sunday in February in a non-leap year is not the 29th
+assert equal (meetup 2015 2 last Sunday) "2015-02-22"
+# when first Friday is the 7th, the last day of the first week
+assert equal (meetup 2012 12 first Friday) "2012-12-07"

From 8d8096a1d518f572eaae65e680c5de6042f290c2 Mon Sep 17 00:00:00 2001
From: Yanni Papandreou <yanni.papandreou@moodys.com>
Date: Mon, 27 Jul 2026 09:25:42 +0000
Subject: [PATCH 10/14] fixed deprecation warnings in nushell version 0.114.1

---
 exercises/practice/acronym/.meta/example.nu            |  4 ++--
 exercises/practice/forth/.meta/example.nu              | 10 +++++-----
 exercises/practice/grep/.meta/example.nu               |  4 ++--
 exercises/practice/isogram/.meta/example.nu            |  2 +-
 .../parallel-letter-frequency/.meta/example.nu         |  2 +-
 5 files changed, 11 insertions(+), 11 deletions(-)

diff --git a/exercises/practice/acronym/.meta/example.nu b/exercises/practice/acronym/.meta/example.nu
index 2be0215..29aecea 100644
--- a/exercises/practice/acronym/.meta/example.nu
+++ b/exercises/practice/acronym/.meta/example.nu
@@ -1,5 +1,5 @@
 def alphabetic [c: string] {
-    let c = $c | str downcase 
+    let c = $c | str lowercase 
     $c >= a and $c <= z
 }
 export def abbreviate [phrase: string] {
@@ -10,5 +10,5 @@ export def abbreviate [phrase: string] {
     | split row -r "[ -]"
     | each {|w| $w | split chars | first}
     | str join
-    | str upcase
+    | str uppercase
 }
diff --git a/exercises/practice/forth/.meta/example.nu b/exercises/practice/forth/.meta/example.nu
index b6aece3..5fae0bb 100644
--- a/exercises/practice/forth/.meta/example.nu
+++ b/exercises/practice/forth/.meta/example.nu
@@ -6,7 +6,7 @@ def macro? [item] {
 
 def parse_definition [def: string] {
     let parsed = ($def | parse ": {name} {body} ;")
-    let name = ($parsed.name | get 0 | str trim | str downcase)
+    let name = ($parsed.name | get 0 | str trim | str lowercase)
     let tokens = ($parsed.body | get 0 | str trim | split row " ")
     {
         name: $name,
@@ -17,8 +17,8 @@ def parse_definition [def: string] {
 def replace_tokens [tokens: list<string>, defname: string, definition: list<string>] {
     mut result = []
     for token in $tokens {
-        let token_lower = ($token | str downcase | str trim)
-        let name_lower = ($defname | str downcase | str trim)
+        let token_lower = ($token | str lowercase | str trim)
+        let name_lower = ($defname | str lowercase | str trim)
         if $token_lower == $name_lower {
             for deftoken in $definition {
                 $result = ($result | append $deftoken)
@@ -71,7 +71,7 @@ def expand_macros [instructions: list<string>] {
             mut next = []
             
             for token in $tokens {
-                let token_lower = ($token | str downcase)
+                let token_lower = ($token | str lowercase)
                 let matches = ($defs | where name == $token_lower)
                 if ($matches | length) > 0 {
                     let match = ($matches | first)
@@ -165,7 +165,7 @@ export def evaluate [instructions: list<string>] {
     
     mut stack: list<int> = []
     for token in $tokens {
-        let norm = ($token | str downcase | str trim)
+        let norm = ($token | str lowercase | str trim)
         $stack = perform $stack $norm
     }
     $stack
diff --git a/exercises/practice/grep/.meta/example.nu b/exercises/practice/grep/.meta/example.nu
index 8270cb0..f29f6eb 100644
--- a/exercises/practice/grep/.meta/example.nu
+++ b/exercises/practice/grep/.meta/example.nu
@@ -22,8 +22,8 @@ def grep-single [pattern: string, options: record, file: path] {
         mut upcased  = $line
         mut pattern = $pattern
         if $options.insensitive {
-            $upcased = $upcased | str upcase
-            $pattern = $pattern | str upcase
+            $upcased = $upcased | str uppercase
+            $pattern = $pattern | str uppercase
         }
          
         if $options.inverted xor (do $contains $pattern $upcased) {
diff --git a/exercises/practice/isogram/.meta/example.nu b/exercises/practice/isogram/.meta/example.nu
index 552d7cc..2d8bf3a 100644
--- a/exercises/practice/isogram/.meta/example.nu
+++ b/exercises/practice/isogram/.meta/example.nu
@@ -1,5 +1,5 @@
 def clean [phrase: string] {
-    $phrase | str downcase | split chars | where $it in 'abcdefghijklmnopqrstuvwxyz'
+    $phrase | str lowercase | split chars | where $it in 'abcdefghijklmnopqrstuvwxyz'
 }
 export def is_isogram [phrase: string] {
     let phrase = clean $phrase
diff --git a/exercises/practice/parallel-letter-frequency/.meta/example.nu b/exercises/practice/parallel-letter-frequency/.meta/example.nu
index b621574..047da02 100644
--- a/exercises/practice/parallel-letter-frequency/.meta/example.nu
+++ b/exercises/practice/parallel-letter-frequency/.meta/example.nu
@@ -19,7 +19,7 @@ def merge_add [second] {
 }
 
 def make_chunks [texts: list<string>] {
-    let text = $texts | str join | split chars | str downcase | where $it in "abcdefghijklmnopqrstuvwxyz"
+    let text = $texts | str join | split chars | str lowercase | where $it in "abcdefghijklmnopqrstuvwxyz"
     let n_chunks = ($text | length) // (sys cpu | length)
     let n_chunks = if ($n_chunks <= 0) {
         1

From ce0fa2330cafefd9e101c87faf36508234300033 Mon Sep 17 00:00:00 2001
From: Yanni Papandreou <yanni.papandreou@moodys.com>
Date: Mon, 27 Jul 2026 09:46:35 +0000
Subject: [PATCH 11/14] update nushell release in workflow file

---
 .github/workflows/test.yml | 6 +++---
 1 file changed, 3 insertions(+), 3 deletions(-)

diff --git a/.github/workflows/test.yml b/.github/workflows/test.yml
index f741004..fda149b 100644
--- a/.github/workflows/test.yml
+++ b/.github/workflows/test.yml
@@ -21,11 +21,11 @@ jobs:
 
       - name: Use nushell
         run: |
-          curl -L -o nu.tar.gz https://github.com/nushell/nushell/releases/download/0.111.0/nu-0.111.0-x86_64-unknown-linux-gnu.tar.gz && \
+          curl -L -o nu.tar.gz https://github.com/nushell/nushell/releases/download/0.114.1/nu-0.114.1-x86_64-unknown-linux-gnu.tar.gz && \
           tar -xzf nu.tar.gz && \
-          sudo mv nu-0.111.0-x86_64-unknown-linux-gnu/* /usr/bin/ && \
+          sudo mv nu-0.114.1-x86_64-unknown-linux-gnu/* /usr/bin/ && \
           rm nu.tar.gz && \
-          rm -r nu-0.111.0-x86_64-unknown-linux-gnu
+          rm -r nu-0.114.1-x86_64-unknown-linux-gnu
 
 
       - name: Verify all exercises

From 68ccb06ffd5f44df67607e470da18c9ff3d1a972 Mon Sep 17 00:00:00 2001
From: Yanni Papandreou <yanni.papandreou@moodys.com>
Date: Mon, 27 Jul 2026 10:07:25 +0000
Subject: [PATCH 12/14] rename run to move to avoid errors with existing run
 command

---
 .../practice/robot-simulator/.meta/example.nu |  2 +-
 .../robot-simulator/robot-simulator.nu        |  4 +--
 exercises/practice/robot-simulator/tests.nu   | 34 +++++++++----------
 3 files changed, 20 insertions(+), 20 deletions(-)

diff --git a/exercises/practice/robot-simulator/.meta/example.nu b/exercises/practice/robot-simulator/.meta/example.nu
index 00eda89..1b3f29d 100644
--- a/exercises/practice/robot-simulator/.meta/example.nu
+++ b/exercises/practice/robot-simulator/.meta/example.nu
@@ -15,7 +15,7 @@ def turnl [robot: record<position: record<x: int, y: int>, direction: string>] {
   let idx = $directions | indexof $robot.direction
   $robot | update direction ($directions | get (($idx - 1) mod 4 | into cell-path))
 }
-export def run [instructions: string]: record<position: record<x: int, y: int>, direction: string> -> record<position: record<x: int, y: int>, direction: string> {
+export def move [instructions: string]: record<position: record<x: int, y: int>, direction: string> -> record<position: record<x: int, y: int>, direction: string> {
   let robot = $in
   $instructions | split chars | reduce --fold $robot {|c, robot|
     match $c {
diff --git a/exercises/practice/robot-simulator/robot-simulator.nu b/exercises/practice/robot-simulator/robot-simulator.nu
index a45db0d..a60e76c 100644
--- a/exercises/practice/robot-simulator/robot-simulator.nu
+++ b/exercises/practice/robot-simulator/robot-simulator.nu
@@ -1,4 +1,4 @@
-export def run [instructions: string]: record<position: record<x: int, y: int>, direction: string> -> record<position: record<x: int, y: int>, direction: string> {
-  error make {msg: "Remove this line and implement grep"}
+export def move [instructions: string]: record<position: record<x: int, y: int>, direction: string> -> record<position: record<x: int, y: int>, direction: string> {
+  error make {msg: "Remove this line and implement move"}
   {position: {x: 0, y: 0}, direction: north}
 }
diff --git a/exercises/practice/robot-simulator/tests.nu b/exercises/practice/robot-simulator/tests.nu
index 441dc2b..e9fb21f 100644
--- a/exercises/practice/robot-simulator/tests.nu
+++ b/exercises/practice/robot-simulator/tests.nu
@@ -1,49 +1,49 @@
-use robot-simulator.nu run
+use robot-simulator.nu move
 use std/assert
 # changes north to east
-assert equal ({position: {x: 0, y: 0}, direction: north} | run R) {position: {x: 0, y: 0}, direction: east}
+assert equal ({position: {x: 0, y: 0}, direction: north} | move R) {position: {x: 0, y: 0}, direction: east}
 
 # changes east to south
-assert equal ({position: {x: 0, y: 0}, direction: east} | run R) {position: {x: 0, y: 0}, direction: south}
+assert equal ({position: {x: 0, y: 0}, direction: east} | move R) {position: {x: 0, y: 0}, direction: south}
 
 # changes south to west
-assert equal ({position: {x: 0, y: 0}, direction: south} | run R) {position: {x: 0, y: 0}, direction: west}
+assert equal ({position: {x: 0, y: 0}, direction: south} | move R) {position: {x: 0, y: 0}, direction: west}
 
 # changes west to north
-assert equal ({position: {x: 0, y: 0}, direction: west} | run R) {position: {x: 0, y: 0}, direction: north}
+assert equal ({position: {x: 0, y: 0}, direction: west} | move R) {position: {x: 0, y: 0}, direction: north}
 
 # changes north to west
-assert equal ({position: {x: 0, y: 0}, direction: north} | run L) {position: {x: 0, y: 0}, direction: west}
+assert equal ({position: {x: 0, y: 0}, direction: north} | move L) {position: {x: 0, y: 0}, direction: west}
 
 # changes west to south
-assert equal ({position: {x: 0, y: 0}, direction: west} | run L) {position: {x: 0, y: 0}, direction: south}
+assert equal ({position: {x: 0, y: 0}, direction: west} | move L) {position: {x: 0, y: 0}, direction: south}
 
 # changes south to east
-assert equal ({position: {x: 0, y: 0}, direction: south} | run L) {position: {x: 0, y: 0}, direction: east}
+assert equal ({position: {x: 0, y: 0}, direction: south} | move L) {position: {x: 0, y: 0}, direction: east}
 
 # changes east to north
-assert equal ({position: {x: 0, y: 0}, direction: east} | run L) {position: {x: 0, y: 0}, direction: north}
+assert equal ({position: {x: 0, y: 0}, direction: east} | move L) {position: {x: 0, y: 0}, direction: north}
 
 # facing north increments Y
-assert equal ({position: {x: 0, y: 0}, direction: north} | run A) {position: {x: 0, y: 1}, direction: north}
+assert equal ({position: {x: 0, y: 0}, direction: north} | move A) {position: {x: 0, y: 1}, direction: north}
 
 # facing south decrements Y
-assert equal ({position: {x: 0, y: 0}, direction: south} | run A) {position: {x: 0, y: -1}, direction: south}
+assert equal ({position: {x: 0, y: 0}, direction: south} | move A) {position: {x: 0, y: -1}, direction: south}
 
 # facing east increments X
-assert equal ({position: {x: 0, y: 0}, direction: east} | run A) {position: {x: 1, y: 0}, direction: east}
+assert equal ({position: {x: 0, y: 0}, direction: east} | move A) {position: {x: 1, y: 0}, direction: east}
 
 # facing west decrements X
-assert equal ({position: {x: 0, y: 0}, direction: west} | run A) {position: {x: -1, y: 0}, direction: west}
+assert equal ({position: {x: 0, y: 0}, direction: west} | move A) {position: {x: -1, y: 0}, direction: west}
 
 # moving east and north from README
-assert equal ({position: {x: 7, y: 3}, direction: north} | run RAALAL) {position: {x: 9, y: 4}, direction: west}
+assert equal ({position: {x: 7, y: 3}, direction: north} | move RAALAL) {position: {x: 9, y: 4}, direction: west}
 
 # moving west and north
-assert equal ({position: {x: 0, y: 0}, direction: north} | run LAAARALA) {position: {x: -4, y: 1}, direction: west}
+assert equal ({position: {x: 0, y: 0}, direction: north} | move LAAARALA) {position: {x: -4, y: 1}, direction: west}
 
 # moving west and south
-assert equal ({position: {x: 2, y: -7}, direction: east} | run RRAAAAALA) {position: {x: -3, y: -8}, direction: south}
+assert equal ({position: {x: 2, y: -7}, direction: east} | move RRAAAAALA) {position: {x: -3, y: -8}, direction: south}
 
 # moving east and north
-assert equal ({position: {x: 8, y: 4}, direction: south} | run LAAARRRALLLL) {position: {x: 11, y: 5}, direction: north}
+assert equal ({position: {x: 8, y: 4}, direction: south} | move LAAARRRALLLL) {position: {x: 11, y: 5}, direction: north}

From 0e195ea9eda8813dc8cd82a699a8e3a51f2a0ab5 Mon Sep 17 00:00:00 2001
From: Yanni Papandreou <yanni.papandreou@moodys.com>
Date: Tue, 28 Jul 2026 22:19:24 +0100
Subject: [PATCH 13/14] Update exercises/practice/gigasecond/tests.nu

Co-authored-by: J R M <jwrmmine@protonmail.com>
---
 exercises/practice/gigasecond/tests.nu | 3 ---
 1 file changed, 3 deletions(-)

diff --git a/exercises/practice/gigasecond/tests.nu b/exercises/practice/gigasecond/tests.nu
index 45796b8..a2a4ad9 100644
--- a/exercises/practice/gigasecond/tests.nu
+++ b/exercises/practice/gigasecond/tests.nu
@@ -8,6 +8,3 @@ assert equal (add 2015-01-24T22:00:00) 2046-10-02T23:46:40
 assert equal (add 2015-01-24T23:59:59) 2046-10-03T01:46:39
 
 # test immuatability of input
-let orig_moment = 2015-01-24T23:59:59
-let new_moment = add $orig_moment
-assert equal $orig_moment 2015-01-24T23:59:59

From 41e3719e0bf091f95c8801b0f92bf408e5da6668 Mon Sep 17 00:00:00 2001
From: Yanni Papandreou <yanni.papandreou@moodys.com>
Date: Tue, 28 Jul 2026 22:19:36 +0100
Subject: [PATCH 14/14] Update exercises/practice/gigasecond/.meta/tests.toml

Co-authored-by: J R M <jwrmmine@protonmail.com>
---
 exercises/practice/gigasecond/.meta/tests.toml | 1 +
 1 file changed, 1 insertion(+)

diff --git a/exercises/practice/gigasecond/.meta/tests.toml b/exercises/practice/gigasecond/.meta/tests.toml
index a7caf00..7f75cf5 100644
--- a/exercises/practice/gigasecond/.meta/tests.toml
+++ b/exercises/practice/gigasecond/.meta/tests.toml
@@ -26,3 +26,4 @@ description = "full time with day roll-over"
 
 [fcec307c-7529-49ab-b0fe-20309197618a]
 description = "does not mutate the input"
+include = false