Skip to content

format_01.md

Latest commit

 

History

History
151 lines (104 loc) · 5.34 KB

format_01.md

File metadata and controls

151 lines (104 loc) · 5.34 KB
Raw

Module 1: Read Data Formats

We recommend that read data is either submitted in BAM or CRAM format. However, read data can be submitted in several standard and platform specific formats. Reads should always be de-multiplexed into separate files prior submission.

Single cell data submissions should be make using BAM or CRAM format.

Standard formats

The following standard file formats are accepted and transformed into Fastq products:

  • cram
  • bam
  • fastq

CRAM format

Submitted CRAM files must be readable with Samtools and the reference sequences must exist in the CRAM Reference Registry.

CRAM file names are required to end up with the .cram suffix (e.g. 'a.cram').

A CRAM index (CRAI) file is created by the archive for each submitted CRAM file and is available in the same directory as the CRAM file from which is was created. CRAM index file names start with the CRAM file name and end up with the .crai suffix (e.g. 'a.cram.crai' for CRAM file 'a.cram').

BAM format

Submitted CRAM files must be readable with Samtools.

BAM file names are required to end up with the .bam suffix (e.g. 'a.bam').

Fastq format

We recommend that read data is either submitted in BAM or CRAM format. However, single and paired reads are accepted as Fastq files that meet the following the requirements:

  • Quality scores must be in Phred scale.
  • Both ASCII and space delimitered decimal encoding of quality scores are supported. We will automatically detect the Phred quality offset of either 33 or 64.
  • No technical reads (adapters, linkers, barcodes) are allowed.
  • Single reads must be submitted using a single Fastq file and can be submitted with or without read names.
  • Paired reads must split and submitted using either one or two Fastq files. The read names must have a suffix identifying the first and second read from the pair, for example '/1' and '/2' (regular expression for the reads: "^@([a-zA-Z0-9_-]+:[0-9]+:[a-zA-Z0-9]+:[0-9]+:[0-9]+:[0-9-]+:[0-9-]+) ([12]):[YN]:[0-9]*[02468]:[ACGTN]+$").
  • The first line for each read must start with '@'.
  • The base calls and quality scores must be separated by a line starting with '+'.
  • The Fastq files must be compressed using gzip or bzip2.
  • The regular expression for bases is "^([ACGTNactgn.]*?)$”

Example of Fastq file containing single reads:

@read_name
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%++)(%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
...

Example of Fastq file containing paired reads (prior to Casava 1.8):

@read_name/1
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%++)(%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
@read_name/2
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%++)(%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
...

With Casava 1.8 the format of the '@' line has changed and we accept this pattern too:

@EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG

Platform specific formats

Oxford Nanopore

Oxford Nanopore native data must be submitted as a single tar.gz archive containing basecalled fast5 files from Metrichor or Albacore.

For Metrichor, an example directory structure for run named XYZ:

XYZ/reads/downloads/fail/
XYZ/reads/downloads/pass/

How to archive all files in the XYZ downloads directory in a linux command line:

cd <directory containing XYZ directory>
tar -cvzf XYZ.tar.gz XYZ/reads/downloads/

PacBio

PacBio data submissions are supported in the platform specific native format.

One run consists of *.bax.h5, *.bas.h5 and xml files. Please note that these files must not be tarred.

SFF format

The SFF format is supported for the 454 and Ion Torrent platforms.

Formats being deprecated

Complete Genomics native format

The full Complete Genomics data package can be submitted including the ASM, LIB and MAP subfolders. Each data package should be submitted as a single experiment and run. Please note the data package must not be tarred or gzipped for submission.

SRF format

The *_seq.txt files can be converted into SRF files using the illumina2srf utility available from the DNA Sequence Read Toolkit.

Each Illumina lane should be submitted as a separate SRF file and runs should be demultiplexed prior SRF file generation.

To produce a SRF submission file for a non-paired lane, change the working directory to the run folder and run:

illumina2srf -R -P -N <run>:%l:%t: -n %x:%y -o <center_name>_<run>_<lane>.srf s_<lane>_*_seq.txt

The -R, -P options are used to exclude intensity, noise and signal data from the generated SRF files. These data series are no longer supported for new data submissions.

The recommended format for the SRF file names is <center_name>.srf, where <center_name> is the center name abbreviation assigned to all submitters, and the and are the run and the lane identifiers.

To produce a SRF submission file for paired lane, change the working directory to the run folder and run:

illumina2srf -R -P -N <run>:%l:%t: -n %x:%y -2 <cycle> -o <center_name>_<run>_<lane>.srf s_<lane>_*_seq.txt

Deprecated formats

Read submissions are no longer accepted in the following formats:

  • SOLiD csfasta/qual format (support ended in 2015)
  • Illumina qseq format (support ended in 2015)
  • Illumina scarf format (support ended in 2015)